ID: 903960922

View in Genome Browser
Species Human (GRCh38)
Location 1:27057387-27057409
Sequence GGCTCCAGGGTCAAACCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960922_903960929 20 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960929 1:27057430-27057452 TTTGCCACGGGCAGCATCTCAGG No data
903960922_903960925 -8 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG No data
903960922_903960931 24 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960931 1:27057434-27057456 CCACGGGCAGCATCTCAGGAAGG No data
903960922_903960928 8 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960922_903960932 25 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960922_903960933 28 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960933 1:27057438-27057460 GGGCAGCATCTCAGGAAGGGAGG No data
903960922_903960927 7 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960922 Original CRISPR GGCTCCAGGGTCAAACCATC TGG (reversed) Intergenic