ID: 903960923

View in Genome Browser
Species Human (GRCh38)
Location 1:27057400-27057422
Sequence ACACAAAAGTGCAGGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960923_903960929 7 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960929 1:27057430-27057452 TTTGCCACGGGCAGCATCTCAGG No data
903960923_903960932 12 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960923_903960934 20 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960934 1:27057443-27057465 GCATCTCAGGAAGGGAGGCTTGG No data
903960923_903960937 27 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960937 1:27057450-27057472 AGGAAGGGAGGCTTGGACAGGGG No data
903960923_903960933 15 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960933 1:27057438-27057460 GGGCAGCATCTCAGGAAGGGAGG No data
903960923_903960927 -6 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data
903960923_903960935 25 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960935 1:27057448-27057470 TCAGGAAGGGAGGCTTGGACAGG No data
903960923_903960928 -5 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960923_903960936 26 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960936 1:27057449-27057471 CAGGAAGGGAGGCTTGGACAGGG No data
903960923_903960931 11 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960931 1:27057434-27057456 CCACGGGCAGCATCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960923 Original CRISPR ACACAAAAGTGCAGGCTCCA GGG (reversed) Intergenic