ID: 903960924

View in Genome Browser
Species Human (GRCh38)
Location 1:27057401-27057423
Sequence CACACAAAAGTGCAGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960924_903960929 6 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960929 1:27057430-27057452 TTTGCCACGGGCAGCATCTCAGG No data
903960924_903960937 26 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960937 1:27057450-27057472 AGGAAGGGAGGCTTGGACAGGGG No data
903960924_903960932 11 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960924_903960927 -7 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data
903960924_903960936 25 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960936 1:27057449-27057471 CAGGAAGGGAGGCTTGGACAGGG 0: 2
1: 0
2: 4
3: 55
4: 507
903960924_903960928 -6 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960924_903960931 10 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960931 1:27057434-27057456 CCACGGGCAGCATCTCAGGAAGG No data
903960924_903960933 14 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960933 1:27057438-27057460 GGGCAGCATCTCAGGAAGGGAGG No data
903960924_903960935 24 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960935 1:27057448-27057470 TCAGGAAGGGAGGCTTGGACAGG No data
903960924_903960934 19 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960934 1:27057443-27057465 GCATCTCAGGAAGGGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960924 Original CRISPR CACACAAAAGTGCAGGCTCC AGG (reversed) Intergenic
No off target data available for this crispr