ID: 903960925

View in Genome Browser
Species Human (GRCh38)
Location 1:27057402-27057424
Sequence CTGGAGCCTGCACTTTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960919_903960925 5 Left 903960919 1:27057374-27057396 CCATGCTTTTAGCCCAGATGGTT No data
Right 903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG No data
903960917_903960925 21 Left 903960917 1:27057358-27057380 CCAATCGGAGGCAGAGCCATGCT No data
Right 903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG No data
903960922_903960925 -8 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG No data
903960921_903960925 -7 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960925 Original CRISPR CTGGAGCCTGCACTTTTGTG TGG Intergenic
No off target data available for this crispr