ID: 903960926

View in Genome Browser
Species Human (GRCh38)
Location 1:27057408-27057430
Sequence ATGCAGCCACACAAAAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960926_903960932 4 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960926_903960931 3 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960931 1:27057434-27057456 CCACGGGCAGCATCTCAGGAAGG No data
903960926_903960934 12 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960934 1:27057443-27057465 GCATCTCAGGAAGGGAGGCTTGG No data
903960926_903960935 17 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960935 1:27057448-27057470 TCAGGAAGGGAGGCTTGGACAGG No data
903960926_903960929 -1 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960929 1:27057430-27057452 TTTGCCACGGGCAGCATCTCAGG No data
903960926_903960936 18 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960936 1:27057449-27057471 CAGGAAGGGAGGCTTGGACAGGG 0: 2
1: 0
2: 4
3: 55
4: 507
903960926_903960937 19 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960937 1:27057450-27057472 AGGAAGGGAGGCTTGGACAGGGG No data
903960926_903960933 7 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960933 1:27057438-27057460 GGGCAGCATCTCAGGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960926 Original CRISPR ATGCAGCCACACAAAAGTGC AGG (reversed) Intergenic
No off target data available for this crispr