ID: 903960927

View in Genome Browser
Species Human (GRCh38)
Location 1:27057417-27057439
Sequence TTGTGTGGCTGCATTTGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960922_903960927 7 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data
903960923_903960927 -6 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data
903960924_903960927 -7 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data
903960921_903960927 8 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data
903960919_903960927 20 Left 903960919 1:27057374-27057396 CCATGCTTTTAGCCCAGATGGTT No data
Right 903960927 1:27057417-27057439 TTGTGTGGCTGCATTTGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960927 Original CRISPR TTGTGTGGCTGCATTTGCCA CGG Intergenic
No off target data available for this crispr