ID: 903960928

View in Genome Browser
Species Human (GRCh38)
Location 1:27057418-27057440
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960924_903960928 -6 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960919_903960928 21 Left 903960919 1:27057374-27057396 CCATGCTTTTAGCCCAGATGGTT No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960922_903960928 8 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960921_903960928 9 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data
903960923_903960928 -5 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960928 1:27057418-27057440 TGTGTGGCTGCATTTGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type