ID: 903960932

View in Genome Browser
Species Human (GRCh38)
Location 1:27057435-27057457
Sequence CACGGGCAGCATCTCAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960923_903960932 12 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960921_903960932 26 Left 903960921 1:27057386-27057408 CCCAGATGGTTTGACCCTGGAGC No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960922_903960932 25 Left 903960922 1:27057387-27057409 CCAGATGGTTTGACCCTGGAGCC No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960924_903960932 11 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data
903960926_903960932 4 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960932 1:27057435-27057457 CACGGGCAGCATCTCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960932 Original CRISPR CACGGGCAGCATCTCAGGAA GGG Intergenic
No off target data available for this crispr