ID: 903960934

View in Genome Browser
Species Human (GRCh38)
Location 1:27057443-27057465
Sequence GCATCTCAGGAAGGGAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960926_903960934 12 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960934 1:27057443-27057465 GCATCTCAGGAAGGGAGGCTTGG No data
903960923_903960934 20 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960934 1:27057443-27057465 GCATCTCAGGAAGGGAGGCTTGG No data
903960924_903960934 19 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960934 1:27057443-27057465 GCATCTCAGGAAGGGAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960934 Original CRISPR GCATCTCAGGAAGGGAGGCT TGG Intergenic
No off target data available for this crispr