ID: 903960936

View in Genome Browser
Species Human (GRCh38)
Location 1:27057449-27057471
Sequence CAGGAAGGGAGGCTTGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 2, 1: 0, 2: 4, 3: 55, 4: 507}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960926_903960936 18 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960936 1:27057449-27057471 CAGGAAGGGAGGCTTGGACAGGG 0: 2
1: 0
2: 4
3: 55
4: 507
903960924_903960936 25 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960936 1:27057449-27057471 CAGGAAGGGAGGCTTGGACAGGG 0: 2
1: 0
2: 4
3: 55
4: 507
903960930_903960936 -8 Left 903960930 1:27057434-27057456 CCACGGGCAGCATCTCAGGAAGG No data
Right 903960936 1:27057449-27057471 CAGGAAGGGAGGCTTGGACAGGG 0: 2
1: 0
2: 4
3: 55
4: 507
903960923_903960936 26 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960936 1:27057449-27057471 CAGGAAGGGAGGCTTGGACAGGG 0: 2
1: 0
2: 4
3: 55
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960936 Original CRISPR CAGGAAGGGAGGCTTGGACA GGG Intergenic
900184339 1:1325855-1325877 CAGCCAGGGAGGCCAGGACAGGG + Intronic
900408736 1:2503570-2503592 CAGAAAGGAAAGCTTGGTCAGGG - Intronic
900611850 1:3547606-3547628 CAGGAAGGGAGGATGGGGCCTGG - Intronic
900702978 1:4059377-4059399 CAGGAAGGGAGACTTGGCGAGGG - Intergenic
901032438 1:6315112-6315134 CATGAAGGGTGTCTTGGAAAGGG - Intronic
901642563 1:10700331-10700353 CTAGAAGGGAGGCTTGGAGCAGG - Intronic
902161201 1:14531750-14531772 CAGCAAGGGAAGCTTTGAAATGG + Intergenic
902334950 1:15749347-15749369 GAGGAGGGGAGGCCTGGAGAGGG + Intergenic
902359765 1:15935990-15936012 CAGGAAGGGGGACAGGGACAGGG - Exonic
902379375 1:16045456-16045478 CAGGCAGAGAGGCTGGGGCAGGG - Intronic
903279901 1:22244474-22244496 AAGGAAGGGAGGCTTGAAGGAGG + Intergenic
903452386 1:23463046-23463068 CAGGAAGGGAGGCGTGCTCTGGG + Intronic
903933694 1:26879842-26879864 GAGGAAGAGAGGGATGGACATGG - Intronic
903960936 1:27057449-27057471 CAGGAAGGGAGGCTTGGACAGGG + Intergenic
904405862 1:30287533-30287555 GAGGAAGGAGGGCTTGGGCAAGG + Intergenic
904874590 1:33644294-33644316 CAGGCAGGTAGGCATGAACAAGG + Intronic
904929281 1:34073506-34073528 TAGGGAGTGAGGCTGGGACAAGG + Intronic
905013119 1:34760254-34760276 GAGGAGGGGAGGGTTGGACATGG + Intronic
905171240 1:36111052-36111074 CAGGAAAGGAGGATGGGAAAGGG - Intronic
905632887 1:39528627-39528649 CAGGAAAGGAGGCTGTGAAAAGG + Intergenic
905992480 1:42350748-42350770 CAGGAATGGAGTTTTGGAGAAGG - Intergenic
906458649 1:46020391-46020413 CTGGAAGGTAGGCTGTGACAGGG + Intronic
907429583 1:54404489-54404511 AAAGAAGGGAGGCTTGGAGCAGG - Intronic
907884589 1:58581087-58581109 CAGGTGGTGAGGCTTAGACAAGG - Intergenic
908089324 1:60669888-60669910 CAGGAAGGGAGTTTAGGAAAAGG + Intergenic
908089344 1:60670007-60670029 AAGGAGGGGAGGCTGGAACATGG + Intergenic
910220172 1:84881726-84881748 CAGGGAGGCAGGATTGGAAAGGG + Intronic
911037451 1:93565940-93565962 CAGGAAGGAGGGCTTTGCCAAGG - Intronic
911371751 1:97002529-97002551 GAGGGAGGGAGGCTTGGAATTGG - Intergenic
912383120 1:109258166-109258188 CAGGAGCGGTGGCTTGGGCAGGG + Intronic
912415286 1:109504274-109504296 GAGGAATGGGGTCTTGGACACGG + Exonic
912558633 1:110534460-110534482 CAGGGAGGGAGGTTTGCTCAAGG + Intergenic
914689104 1:150010192-150010214 CAGGAAGGGAGGCCGGGAGCTGG + Intronic
915934143 1:160081037-160081059 AAGGAAGGGAGGCAGGGTCAGGG - Intergenic
918058834 1:181045250-181045272 CAGGACAAAAGGCTTGGACATGG + Intronic
918099986 1:181364893-181364915 CAGGAAGGGGGCCATGGGCAGGG - Intergenic
918985245 1:191616889-191616911 CAGGAAAAGAGGCTTGAAAATGG - Intergenic
919853654 1:201691007-201691029 CAGGAAGTGAAGCTTGGGGAGGG + Intronic
919987421 1:202685591-202685613 CATGAAGGGATGCTTGGGCGGGG + Intronic
920101111 1:203517537-203517559 CAGGAAGGGAGCCTTGGGCTGGG + Intergenic
920286297 1:204882228-204882250 CATGAAGGAAGGCATGGCCAGGG - Intronic
920779019 1:208969813-208969835 CAGGGTGGGAAGCTTGGTCAAGG + Intergenic
921033667 1:211356060-211356082 CAGGAGGTGAAGCTTGGCCAAGG - Intronic
921252416 1:213310348-213310370 CAGGGAGGGAGGATGGGATACGG - Intergenic
922421873 1:225465843-225465865 CAGGAAGGGGGCCTTGGGCTTGG + Intergenic
922478274 1:225921781-225921803 CTGGCAGGCAGGCTTGGACTGGG - Intronic
922546961 1:226465161-226465183 AAGGAAGGGATGCTTGGATAGGG - Intergenic
924627985 1:245711551-245711573 CTGGAGGTGAGGCCTGGACAAGG - Intergenic
1063225777 10:4013477-4013499 CAGGAAGGGAGGGAGGGAGAGGG - Intergenic
1065772873 10:29093968-29093990 CATGGAGGGAGGCTGGGGCATGG - Intergenic
1066188766 10:33036752-33036774 CAGTGAGGGAGGCGTGGCCAGGG + Intergenic
1066298223 10:34074774-34074796 AAGGAAGGCAGGCTAGCACAGGG + Intergenic
1066501346 10:35997740-35997762 CAGGAAGGGCTTCTTGGATATGG + Intergenic
1066533737 10:36367561-36367583 CAGGCAGGCAGGCTTGGAAGAGG + Intergenic
1066629215 10:37442054-37442076 CAGGAAGGGCTTCTTGGATATGG + Intergenic
1067017726 10:42770403-42770425 CAGGAAGGAAGGCCAGGAGAGGG - Intergenic
1067443889 10:46328571-46328593 CAGCAAGGGAGACTGGGAAAAGG + Intronic
1068157819 10:53223469-53223491 CTGCAGGGGAGGCTTGGCCAGGG - Intergenic
1068283725 10:54909368-54909390 CTGGGAGGGAGGCTGAGACAGGG - Intronic
1069720632 10:70547473-70547495 CTGGAAGGGTGGCTGGGGCAGGG - Intronic
1070323574 10:75373000-75373022 AAGGAAGGGAGGCTGGGGGAAGG + Intergenic
1071601465 10:86960524-86960546 CAGGGAGGGAGGCTAGGCCCTGG - Intronic
1072301071 10:94063014-94063036 CAGGAAGGGAGGCTTGGACATGG - Intronic
1073488634 10:103838018-103838040 CAACAAGGGAGGCATGGGCATGG + Intronic
1074925767 10:118068934-118068956 CAAGAACGGAGGCTGGGAAAAGG - Intergenic
1075440799 10:122477926-122477948 AAGGAAGGGAGGCTGGGACAGGG + Intronic
1075494952 10:122912040-122912062 AACAAAGGGAGGCTTGGCCAAGG - Intronic
1076067896 10:127463705-127463727 CAGGAAGGGAGAAAAGGACATGG - Intergenic
1076667779 10:132102805-132102827 ATGGGAGGGAGACTTGGACATGG - Intergenic
1077077120 11:706841-706863 GAGGAGGGGAGGCTGGGACAGGG + Intronic
1077428287 11:2498451-2498473 GAGGCTGGGAGGCTTGGACTGGG - Intronic
1077813021 11:5658021-5658043 CAGGAGTGGAGGCTTTGTCAGGG - Intergenic
1078345669 11:10545309-10545331 CAGTGAGGGAGGCCTGGCCAGGG - Intergenic
1078356526 11:10635970-10635992 ATGGAAGGGAAGCTTGGGCAGGG + Intronic
1078567356 11:12427989-12428011 GAGGAGGGGAGGCCTGGAGATGG - Intronic
1079086064 11:17445820-17445842 AAGGGAGGGGGGCTGGGACAGGG + Intronic
1079133212 11:17761628-17761650 AAGGAAAGGAGGCCTGGACTTGG - Intronic
1079170712 11:18092654-18092676 CAGGAAGGGAATCATGTACATGG + Intronic
1079323696 11:19473629-19473651 CTGTGAGGGAGGCTTGGAAATGG + Intronic
1079444566 11:20547068-20547090 CAGAAAGGGAGGCCTGGAAAAGG - Intergenic
1079905900 11:26246818-26246840 TAGGCAAGAAGGCTTGGACAGGG - Intergenic
1080163648 11:29210726-29210748 GGGGAAGGAAAGCTTGGACATGG - Intergenic
1081082285 11:38756781-38756803 CAGCAGGGGAGGCATGGTCAGGG - Intergenic
1083476174 11:62917108-62917130 CAGTTAAGGAGACTTGGACAAGG - Intronic
1083611253 11:64005495-64005517 CAGGAAGGGGGGCCTGGGCAAGG + Intronic
1083726549 11:64631340-64631362 CAGGGACGGAGGCCTGGAGAAGG + Intronic
1083728658 11:64641768-64641790 CAGGAGGGGAAGCCTGGAAACGG + Intronic
1084045563 11:66565990-66566012 CTGGAAGTGAGGGTGGGACATGG - Intronic
1084117179 11:67049223-67049245 CAGGAAGGGCCTCTTTGACAAGG + Exonic
1084628042 11:70323976-70323998 AAGAAAAGGAGGCTAGGACAGGG + Intronic
1085055274 11:73399493-73399515 CAGGAAGGGAGGCTGGGTGGAGG + Intergenic
1085757221 11:79211892-79211914 CAGGAAGGCAGGGGAGGACAAGG + Intronic
1086567129 11:88239951-88239973 CAGGAAAGGAGGGTTGTAGAAGG + Intergenic
1086846398 11:91755060-91755082 AAGGAAAGGAGGCTGGGGCATGG - Intergenic
1089161254 11:116439195-116439217 GAGGAAGGGAGGGTTGAAGAAGG + Intergenic
1089576808 11:119450339-119450361 CAACAAGGGAGGCTGGGAAATGG + Intergenic
1090494382 11:127195707-127195729 CAGAAAGGGAGGCTGGGTCTGGG - Intergenic
1091375399 12:21879-21901 AAGCAAGGGATGCTTGGAGATGG - Intergenic
1091776405 12:3187791-3187813 CAGGAAGGGCTTCTTGGAGAAGG - Intronic
1091959985 12:4685584-4685606 GAGGAAGAGAGGCTTTGGCAGGG - Intronic
1091992924 12:4971322-4971344 AAGGAAAGGAGACCTGGACATGG + Intergenic
1092977367 12:13758234-13758256 TGGGAAGGGAAGATTGGACAAGG - Intronic
1093025278 12:14240222-14240244 CAGGAAGTGAGGCGCAGACATGG - Intergenic
1094839356 12:34336478-34336500 GAGGCAGGGAGGCTTGAACGGGG + Intergenic
1094842913 12:34349475-34349497 GAGGCAGGGAGGCTTGAAAAGGG - Intergenic
1095050380 12:37548779-37548801 CAGGCAGAGAGGCTGGGAGAGGG - Intergenic
1095319081 12:40803802-40803824 CAGGAAGGGAGGAGAGGAGAAGG + Intronic
1096157008 12:49346511-49346533 CAGGAAGGGAGGAGTGGGGAGGG - Intergenic
1096180200 12:49546490-49546512 CAGGCAAGGAAGCTTGGAGAAGG - Intronic
1096355672 12:50938586-50938608 CAGTAGGGGAGGCATGGCCAGGG - Intergenic
1096582137 12:52592532-52592554 CAGGGAGGGAGGGATGGGCAGGG - Intronic
1097055847 12:56248714-56248736 CAGGAGGGGAGGCAGGGGCAGGG - Intronic
1097450755 12:59734229-59734251 CTGGGAGGGAGGCTGGGGCAGGG - Intronic
1098613938 12:72499016-72499038 CAGGAAGGGAGGGAAGGACAGGG + Intronic
1100016214 12:90013881-90013903 CATGAACAGAGGCCTGGACACGG - Intergenic
1100065722 12:90641516-90641538 AAGGAAGGGAGGCATGGGAAGGG + Intergenic
1101154566 12:101915494-101915516 CAGGCAGAGAGGCTTGTACTTGG + Intronic
1101268073 12:103113189-103113211 CAGGAAGAGAGGCTAGAACAAGG - Intergenic
1101445358 12:104733439-104733461 CTGGGAGGGAGGGTTGAACACGG - Intronic
1102196064 12:111025842-111025864 CAGGAAGGGAGGGTGGGAGGAGG + Intergenic
1102913672 12:116737554-116737576 AAGGAAGGGAGGCAGGGAGAGGG + Intronic
1103380367 12:120489530-120489552 AAGGAATGGTGGCTTGGACAAGG - Intronic
1103535103 12:121628481-121628503 CAGGAATTGAGGCCCGGACAGGG - Intronic
1103805748 12:123571390-123571412 CAGCAAAGGAGGCTGGGAAATGG - Intergenic
1105222487 13:18345011-18345033 CAGGAAGATAAGCTTGCACAAGG - Intergenic
1105344561 13:19561019-19561041 CAGGCAGAGGCGCTTGGACAGGG + Intergenic
1105913341 13:24891428-24891450 CAGGAACTCAGGCTTGGACAGGG - Intronic
1106003679 13:25749233-25749255 CAGGAAGACAGGCCTGGAAATGG + Intronic
1107314805 13:39119760-39119782 GAGGCAGGGAGGTTTGGACTGGG - Intergenic
1107357120 13:39579230-39579252 CAGGAAGGGAGCCCAGGCCAAGG + Intronic
1108883172 13:55146382-55146404 CAGGGAGGAAGGCTGGGAGAAGG + Intergenic
1109713270 13:66186300-66186322 TGGGAAGTGAGACTTGGACATGG - Intergenic
1110704210 13:78586619-78586641 TAGGAGGGCAGGCTTGGAAATGG + Intergenic
1111679795 13:91428452-91428474 CAGGAACTGAGGCTTGGTCTTGG + Intronic
1111717767 13:91901640-91901662 CAGGAAGGGAGGCCTAGAAATGG + Intronic
1111784344 13:92768635-92768657 CAGAAAGGAAGGAGTGGACAGGG - Intronic
1111968772 13:94888483-94888505 GTGGATGGGAGGGTTGGACAAGG - Intergenic
1112739311 13:102455534-102455556 CAGGAAGGGAGACCTCGCCAGGG + Intergenic
1113741292 13:112714085-112714107 GTGGAAGGGAGGCTGGGACCAGG - Intronic
1116304975 14:43241362-43241384 GAGGAAAGGAGGTTTGGAAATGG - Intergenic
1116661576 14:47717201-47717223 CAGGGAGGGAGACTTGGGGAGGG - Intergenic
1117838309 14:59830568-59830590 AAGGAAAGAAGGCTTGGAAAAGG - Intronic
1118720414 14:68590026-68590048 CAGGGAGGAAGGCTTTGAAATGG - Intronic
1118795430 14:69139521-69139543 GAGAAAAGGAGGCTTGGGCATGG + Intronic
1119079108 14:71675275-71675297 CAGGAGGGGAGGCTGGGGGAAGG + Intronic
1120399456 14:84010506-84010528 CTGGAAAGGAGGCTTATACATGG + Intergenic
1120953254 14:90061324-90061346 CAGAAAGGGAGGTTGGAACAGGG - Intergenic
1121280591 14:92694605-92694627 CAGGAGGGGAGGTCTGAACAGGG + Intergenic
1121329244 14:93039799-93039821 CAGCAAGGGAGACTTTGGCAGGG - Intronic
1121681292 14:95794782-95794804 CAGGAGCGGAGTCTGGGACAGGG + Intergenic
1122003398 14:98683151-98683173 CAGCAAGGGAGGCATGGCCCTGG - Intergenic
1122035883 14:98949187-98949209 CAGGAGGGGCTGCTTGGTCAAGG - Intergenic
1122053647 14:99077594-99077616 CAGGCATGGAGGCTGGGCCATGG - Intergenic
1122107251 14:99467762-99467784 CAGTAAGTGAGCCTGGGACAGGG + Intronic
1122298497 14:100718767-100718789 TAGGGAGAGAGGCTTGGACCAGG + Intergenic
1122318237 14:100838042-100838064 CGGGAGGGGAGGTTTGCACAGGG + Intergenic
1122658716 14:103279787-103279809 CGGGGAGGGAGGCTAGGACTGGG + Intergenic
1122693509 14:103542287-103542309 AAGGCAGGGAGGCTGGGGCAGGG + Intergenic
1122985241 14:105208840-105208862 CAGGATGGGGGGCTTGGAGAAGG - Intergenic
1123181664 14:106477130-106477152 CAGGAAAGGAGGCTGGCTCAGGG - Intergenic
1123206583 14:106719421-106719443 CAGGAAAGGAGGCTGGCTCAGGG - Intergenic
1202945240 14_KI270726v1_random:19598-19620 CAGGAAAGGAGGCTGGCTCAGGG + Intergenic
1123511152 15:21001542-21001564 CAGGAAAGGAGGCTGGCTCAGGG - Intergenic
1123738199 15:23206773-23206795 CAGGAAGGGAGGCCTAGAAATGG + Intergenic
1124289407 15:28435437-28435459 CAGGAAGGGAGGCCTAGAAATGG + Intergenic
1124293815 15:28481871-28481893 CAGGAAGGGAGGCCTAGAAATGG - Intergenic
1125587135 15:40828869-40828891 CAGAAAGGGAGGCTGGGGCATGG - Intergenic
1126819314 15:52486211-52486233 CAGGAAGAGACGCCTGGACATGG - Intronic
1126900057 15:53305593-53305615 CAGGAAGGAAGCCTGGGAAATGG - Intergenic
1127806516 15:62526004-62526026 CAGGAAGGGTGGCTTGGAGTAGG + Intronic
1127861312 15:62996650-62996672 GAGGAAGGGAGGATGGGCCAGGG + Intergenic
1127916477 15:63459350-63459372 CAGGAAGGAAGGCTCGGGCATGG - Intergenic
1128159009 15:65410886-65410908 CAGGATGGGAGGCAGGGAAAGGG + Intronic
1128579191 15:68796993-68797015 CAGGAAGGAAATCTGGGACATGG + Intronic
1128763503 15:70236077-70236099 AAGAAATGGAGGCTTGGAGAAGG + Intergenic
1128818081 15:70629082-70629104 CTGGAAGGAAGGAGTGGACAGGG + Intergenic
1129376826 15:75138751-75138773 CAGGGAAGGAGGCTTAGGCAAGG + Intergenic
1129607252 15:77030950-77030972 CCTGAAGGGAGGCTGGGGCAGGG + Intronic
1129699039 15:77757104-77757126 AAGGCAGGGTGGCTTGGCCAAGG - Intronic
1130271466 15:82452145-82452167 AAGGAAGGGTGGGTGGGACATGG - Intergenic
1130345800 15:83043568-83043590 CAGGGATGGTGGCCTGGACAAGG + Intronic
1130474617 15:84253514-84253536 AAGGAAGGGAGGGCTGGGCACGG - Intergenic
1130488868 15:84415302-84415324 AAGGAAGGGTGGGTGGGACATGG + Intergenic
1130636172 15:85622390-85622412 GAGGAAGGAAGGAATGGACAGGG + Intronic
1130838186 15:87672453-87672475 AAGGAAGGCAGGCTGGGAAATGG - Intergenic
1131547031 15:93324130-93324152 CATGAAGAGAGGCTGGGACCGGG + Intergenic
1131651408 15:94403671-94403693 CAGGAAGGGAGGCTTAGAAATGG + Intronic
1132250580 15:100332898-100332920 CAGGAAGGAGGGGTTGTACAGGG + Intronic
1132389233 15:101426692-101426714 CAGGCAGGGAGGTTGGGCCACGG - Intronic
1132496976 16:268513-268535 CACGAAGGAAGACTTGGGCAGGG + Exonic
1132751032 16:1457845-1457867 CAGGCAGAGTGGCTGGGACACGG + Intronic
1133388927 16:5393353-5393375 CAGGCAGGGCTGCCTGGACACGG - Intergenic
1133570250 16:7033655-7033677 GAGGAAGGGAGGCTGGGATGGGG + Intronic
1133603394 16:7361648-7361670 CAGGGAAGGATGCTTGGATATGG + Intronic
1134193060 16:12137330-12137352 CTGCAGGGGAGGCTTGGACAAGG - Intronic
1134568990 16:15275321-15275343 CAGGCGGGGAGGCTTGTACAAGG - Intergenic
1134630612 16:15753288-15753310 CAGGAGGGGAGGCCTTTACATGG - Intronic
1134733447 16:16481041-16481063 CAGGCGGGGAGGCTTGTACAAGG + Intergenic
1134934055 16:18231241-18231263 CAGGCGGGGAGGCTTGTACAAGG - Intergenic
1136065912 16:27758407-27758429 CAGTAAGGATGGCTTGAACAAGG - Intronic
1136497944 16:30655254-30655276 CAGGGAAGGAGGCTGGGACCAGG - Intronic
1137531041 16:49279370-49279392 CCGGAAGGGAGGCAGGGAGAGGG - Exonic
1138530613 16:57632294-57632316 CAGCAAGGGTGGCTTGCCCAGGG + Intronic
1138556959 16:57776350-57776372 GAGGCAGGGTGGCGTGGACAGGG - Intronic
1138580262 16:57936378-57936400 TAGGCCGAGAGGCTTGGACAGGG - Intronic
1139467352 16:67161031-67161053 CAGGAAGCGAGGCGTGGGCGGGG - Intronic
1139519422 16:67472067-67472089 CAGGAATGGAGGCTAGGGCTAGG - Intronic
1139789878 16:69424933-69424955 AAGGAAGGGAGGCTTGGCTGGGG + Intronic
1139964268 16:70736899-70736921 CAGGGAGGGCGGGCTGGACAGGG + Intronic
1141710787 16:85697873-85697895 CAGGAAGGGAGGTTGAGACCGGG + Intronic
1141902651 16:87002725-87002747 CAGGATGGGAGGGCTGGTCATGG - Intergenic
1142805937 17:2371232-2371254 CAGGAAGGGTGGCATGGTCAGGG - Intronic
1142946386 17:3432905-3432927 CATGAAGGGAGCCCTGGAAAGGG - Exonic
1143384825 17:6522803-6522825 CAGTAAGGCAGGCTGGGACAAGG - Intronic
1144026828 17:11284868-11284890 GAGGAATGGAGCCCTGGACAAGG - Intronic
1144029386 17:11305829-11305851 CAGCTAGGGAGGCTGGGAGATGG + Intronic
1144029590 17:11307569-11307591 CAGCAAGGGAGGCTGGGGAATGG + Intronic
1144684438 17:17216600-17216622 CAGGAGGGAGGGCTTGGACCGGG - Intronic
1144892460 17:18501768-18501790 GAGGAAGAGTGACTTGGACAAGG + Intergenic
1145139754 17:20442520-20442542 GAGGAAGAGTGACTTGGACAAGG - Intergenic
1145286049 17:21506606-21506628 CGGGTAGGCAGGCATGGACAAGG + Intergenic
1145391557 17:22459685-22459707 CGGGTAGGCAGGCATGGACAAGG - Intergenic
1145995820 17:29104273-29104295 CAGGAAGGGAGGCTAGAGCCTGG + Intronic
1146474077 17:33148003-33148025 CAGGAAGTGAGGCCTGGAGAGGG + Intronic
1146474554 17:33152602-33152624 TAGGAAGGGAGGCTGGCACATGG + Intronic
1146809204 17:35890039-35890061 CAGGAAGGGAGGGGAGGAGAGGG - Intergenic
1147431850 17:40376099-40376121 CAGGAGGGGAGGCTCAGGCATGG - Intergenic
1148143053 17:45341957-45341979 GAGGAAGGGAGGCCTGGAGAAGG - Intergenic
1149435977 17:56633888-56633910 CAGGAAGGGAGGGTCGGAGCAGG - Intergenic
1150002577 17:61451255-61451277 CAGGCGGGGAGGCTGGGGCACGG + Intergenic
1151412025 17:73937291-73937313 GAGGAAGGGATGCTAGGGCAAGG + Intergenic
1151502445 17:74500000-74500022 CAGGAAGGGCTGCTTGCATAGGG + Intergenic
1151786393 17:76277117-76277139 CAGGGAGGGAGGCCCTGACATGG - Intronic
1151877355 17:76874438-76874460 CCGGAAGGGTGGCTTGGGGAAGG + Intronic
1152201566 17:78950034-78950056 CAGGGAGGGAGCTGTGGACATGG + Intergenic
1152824747 17:82457790-82457812 CAGGAAGGAAGGCTCTAACATGG + Intergenic
1152888841 17:82868296-82868318 GAGGAAAGGTGGCTTGGAGAGGG + Intronic
1153514646 18:5892093-5892115 CTGGGATGGAGGCTTGCACAGGG + Exonic
1153807019 18:8717659-8717681 CAGGGATGGAGGCCTGGACCAGG + Intronic
1153979742 18:10298549-10298571 GAGGAAGCGAGGCTCGGAGAGGG - Intergenic
1154097576 18:11432377-11432399 CAGGGAGGGTGGCTCGGGCATGG + Intergenic
1154357663 18:13633917-13633939 CAGCAGGGGAGGCATGGCCAGGG - Intronic
1155231272 18:23777703-23777725 TAGGAAGGGAGACTTGGCCTTGG - Intronic
1155578469 18:27276214-27276236 CAGCAAGGGAGACTTGAAGAAGG + Intergenic
1156491408 18:37498525-37498547 CAGGAAGGGAGGGAGGGAGAAGG - Intronic
1157807012 18:50665670-50665692 CAGCCAGGGAGGGTAGGACAGGG - Intronic
1158407686 18:57174681-57174703 CAGGAAGAAAGGACTGGACAGGG + Intergenic
1158627878 18:59087482-59087504 CTGCAAGGGAGGCTGGGAAATGG - Intergenic
1158829305 18:61260224-61260246 GAGAAAGGGAGGCGTGGGCAGGG - Intergenic
1159774406 18:72586166-72586188 CAGCAGGGGAGGCATGGCCAGGG - Intronic
1161251483 19:3282650-3282672 CAGGAAGGGAGGCCGTGGCAGGG + Intronic
1161488934 19:4551141-4551163 CAGGGATGGGGGCCTGGACAGGG - Intronic
1161582626 19:5089020-5089042 CAGGAAGGGATGCTTGGGTGTGG + Intronic
1161635741 19:5387902-5387924 CAGGAAGAGAGACTTGATCATGG + Intergenic
1161768257 19:6218347-6218369 CTGGGAGGGAGGCTGGGGCAGGG + Intronic
1161901614 19:7123564-7123586 GAGGAAAGGAGGGTTGGACAGGG - Intronic
1162081132 19:8218527-8218549 CAGACAGGGAGGCCAGGACAGGG + Intronic
1162523238 19:11194016-11194038 CAGGTGGGGAGGCTGGGCCAGGG + Exonic
1163607950 19:18286037-18286059 CAGGAAGGGTTTCTTGGAGAAGG - Intergenic
1163647134 19:18495818-18495840 CTGTAGGGGAGACTTGGACATGG + Intronic
1163717508 19:18880545-18880567 CAGGAAGGGTGGCTTTGAAGAGG - Intronic
1163747417 19:19056699-19056721 CAGCCAGGGAGGTGTGGACAGGG - Intronic
1163795941 19:19338018-19338040 CCGGAAGGCAGGCTGGGTCATGG - Intronic
1164161246 19:22626803-22626825 CAGACAAGGAGGCTTGCACAAGG - Intergenic
1164831676 19:31326799-31326821 CAGTAAGGGAGACTGAGACATGG - Intronic
1165343090 19:35226134-35226156 CAGGAAGGGATGCTGGGAATAGG - Intronic
1165397155 19:35570722-35570744 CAGGAAGGGTGGGATGGAGAAGG + Intergenic
1165728664 19:38130316-38130338 CAGGAAGCCAGGCTGGGACCGGG + Intronic
1165815114 19:38637121-38637143 CAGGAAGGTAGGGTGGGGCAAGG - Intergenic
1166200408 19:41233885-41233907 CAGGAAGTGAGACCTGGAAAGGG - Intronic
1166218918 19:41353195-41353217 GTGGAGGGGAGGCTTGGACCGGG + Exonic
1166241890 19:41500087-41500109 CAGAAAGAGAGGCGGGGACAGGG + Intergenic
1166690961 19:44821030-44821052 AAGGAAGGGAGGGCTGGGCAGGG - Exonic
1166751037 19:45164123-45164145 GAGGAAGGGAGGTGTGGACAAGG + Intronic
1168089099 19:54070355-54070377 GAGGCAGGGAGGCTTGAACCTGG - Intronic
1168291871 19:55361115-55361137 GAGGAAGGGACGGTTAGACAGGG + Intronic
1168301146 19:55405900-55405922 CAGGAAGCTAGCCTTGGAGATGG - Intronic
1168655840 19:58127175-58127197 CAGAAAGAGAGGCTTTGGCAGGG - Exonic
924966702 2:83199-83221 CAGGAAGGGGGGCATGGGAAGGG - Intergenic
925021807 2:575549-575571 TAGGAAGAGAAGCCTGGACATGG + Intergenic
925435502 2:3834110-3834132 CAGCAGGGGAGGCTTGGGCCAGG - Intronic
925764012 2:7213524-7213546 CAGGAACGGAAGCTTAGACCTGG - Intergenic
925786846 2:7439859-7439881 GATGATGGGAGGCTTGGTCAAGG + Intergenic
925917534 2:8617374-8617396 CAGGAGTGGGGGCTTGGAAACGG - Intergenic
925976425 2:9145349-9145371 AAGAAACGGAGGCTTGGAGAGGG - Intergenic
926175004 2:10583030-10583052 CAGGAATGAAGGCTGGGAAAAGG - Intronic
926227505 2:10978768-10978790 CAAGAAGGGAGCCTTGGGGATGG + Intergenic
926887471 2:17611552-17611574 CAGGAAGGGGGCCTTGAACTTGG + Intronic
927096886 2:19754213-19754235 CATGAACAGAGGCCTGGACAAGG + Intergenic
927375359 2:22406963-22406985 CTGGAAGGGAAGCTTGGCTATGG - Intergenic
927666502 2:25036520-25036542 CAGAAAGGGAGGCTTAGAAGTGG - Intergenic
927887398 2:26727119-26727141 CAGGAAGGGAGACTGAGGCAGGG - Intronic
928909119 2:36400783-36400805 TTGGGAGGGAGGCTTGTACAGGG + Intronic
928921782 2:36534482-36534504 CAGGAAGGAAGGGAAGGACAGGG + Intronic
929548636 2:42875029-42875051 CAGGAGGGGAGGCGTGGAGTGGG + Intergenic
930065882 2:47327219-47327241 CAAGAAGGGGGCCTTGGAAAAGG + Intergenic
930259159 2:49124946-49124968 CAGGAATGGATGAGTGGACAGGG - Intronic
930366529 2:50446457-50446479 CAGGAAGGGAGGGAGGAACAGGG - Intronic
931128381 2:59303093-59303115 CAGTAAGGCAGGCCTGGAAAGGG - Intergenic
931254099 2:60555248-60555270 CAGGCAGGGAGGCTGGGAGGCGG - Intergenic
931766231 2:65459049-65459071 GAGGAGGGGAGGCTGGGAAAGGG - Intergenic
932464492 2:71907599-71907621 CAGGGTGGGAGACTTGGAGAAGG - Intergenic
932589871 2:73058950-73058972 AAGGCAGGGAGGCTGGGAGAGGG - Intronic
932629112 2:73323087-73323109 CAGGCAGAGAAGCTAGGACAGGG + Intergenic
934055584 2:88248737-88248759 CCAGAGGTGAGGCTTGGACATGG - Intergenic
934763206 2:96867523-96867545 CAAGAAGCGAGGCGTGGAGAGGG + Intronic
937111981 2:119373480-119373502 CCGGAAGAGTGGCTTAGACAAGG + Intergenic
937334851 2:121055787-121055809 GAGGAAGGGATGCTGAGACATGG + Intergenic
938133842 2:128737677-128737699 CAGAAAGGGAGGTGTGGGCATGG - Intergenic
938810246 2:134846115-134846137 CAGGCAGGGAGGCTTGCCCAGGG + Intronic
940090322 2:149909046-149909068 CAGGAAGGAATCCTTGGACAGGG + Intergenic
941505778 2:166342928-166342950 CATGAAGGTAGGGATGGACAGGG - Intronic
941858048 2:170250505-170250527 CAGGAAGGGGGGCATGCAGATGG + Intronic
942642826 2:178077490-178077512 AAGGAAAGCAGGCTTGGAGAAGG - Intronic
943919005 2:193677946-193677968 GAAGAAAGTAGGCTTGGACATGG + Intergenic
945683054 2:212936781-212936803 CGGGAAGGCAGGCAGGGACAGGG + Intergenic
946156528 2:217810201-217810223 CAGAAAGAGAGGCCTGGGCATGG + Intronic
946577290 2:221089493-221089515 CAGGAAGGCAGGATTGGAGGGGG - Intergenic
947229754 2:227872820-227872842 CTGGAATGGAGGGTTGGACTAGG - Intronic
947806025 2:232968729-232968751 CAGCAAGGGAGGCTGGGAAGTGG - Intronic
947879107 2:233489460-233489482 CAGGAAAGGAGGCAAGGTCATGG + Exonic
947932522 2:233975505-233975527 CAGCAAGGGAGGCAGGGTCAGGG - Intronic
948313920 2:237012336-237012358 GAGGAAGGGAGGCATGCTCAGGG + Intergenic
948609561 2:239158116-239158138 AGAGAAGGGAGGCTTGCACAAGG - Intronic
948888650 2:240896473-240896495 CTGGCAGGGAGGCTGGGGCAGGG - Intronic
948969286 2:241412182-241412204 CAGCGAGAGAGGCTTGTACAGGG + Intronic
1169309209 20:4521227-4521249 CAGGAAAAGAGGCGTGGCCAGGG + Intergenic
1169464547 20:5825999-5826021 CAGGAAGGAAGGGCTGCACATGG + Intronic
1169544571 20:6637455-6637477 CAGGAAGGAAGGCTCAGAAAAGG + Intergenic
1169662735 20:7998374-7998396 TATGAAGGTAGGCTTGGCCAAGG - Intronic
1169986640 20:11452368-11452390 GAGGTAGGGAGGCTTTGCCAAGG + Intergenic
1170388972 20:15851498-15851520 CAGAAGAGGAGGTTTGGACACGG - Intronic
1171035930 20:21713028-21713050 GAGGAAGGATGGCTTGGACAGGG + Intronic
1172002128 20:31787453-31787475 CAGAAAGGGAGGTTTTGAAAGGG + Intronic
1172127531 20:32633812-32633834 CATGAAAGGAGGCTGGGACCAGG - Intergenic
1173404795 20:42755101-42755123 CAGGAAGGGAGGTGTGGGCGGGG + Intronic
1174058379 20:47815251-47815273 CAGGACGGGAGGCCAGGGCAAGG + Intergenic
1174160203 20:48545209-48545231 CAGGAAGGGAGGCCAGGGCAAGG - Intergenic
1174177241 20:48652746-48652768 CAGGTAGGGAGGAGGGGACAGGG + Intronic
1174872854 20:54199600-54199622 CAGGGAGGGAGGCTAGGCCCTGG + Intergenic
1174874278 20:54210080-54210102 AAGGAAGGGAGAGTTGGATAGGG + Intronic
1175162859 20:57021803-57021825 CAGGCTGGGAGGCCTGGACCAGG - Intergenic
1175409039 20:58753993-58754015 CAGTAAGGCAAGCTTGGCCATGG - Intergenic
1175437624 20:58965500-58965522 CCTGAAGGGAGGTTTGGGCAAGG + Intergenic
1175470408 20:59223116-59223138 CAGGAAGGGGGCCTTGGAGGAGG + Intronic
1175534412 20:59698014-59698036 TAGGTAAGGAGGCTTGGACCAGG + Intronic
1176731035 21:10497434-10497456 CAGGAAGATAAGCTTGCACAAGG - Intergenic
1176869315 21:14073356-14073378 CAGGATGCCAGGCTTGAACAGGG - Intergenic
1177404204 21:20645281-20645303 CAGTGAGGGAGGTTTGGCCAGGG + Intergenic
1177730801 21:25024983-25025005 CAGCAAGGGAGGCTGTGGCAGGG + Intergenic
1178603947 21:34018894-34018916 CAGGAAGGAAGGCAGGGCCAAGG - Intergenic
1179487222 21:41718066-41718088 CAGGAAGGAAGGTGTGGGCAGGG + Intergenic
1179517511 21:41918726-41918748 CAGGAGGAGTGGCTGGGACAGGG + Intronic
1179823562 21:43951437-43951459 TCGGAAGGGCGGCTTGGGCAGGG + Intronic
1180303587 22:11055784-11055806 CAGGCACGGTGGCTTGGGCATGG - Intergenic
1180589459 22:16923985-16924007 CAGGAAGGATGGCTGGGAGATGG - Intergenic
1180950503 22:19718584-19718606 CGGGAAGTGAGGCCTGGACAGGG - Intronic
1180967650 22:19798939-19798961 CAGGAGGAGAGGCTTGTGCAGGG - Intronic
1180993319 22:19951801-19951823 CAGGAAGGGAGGGTTAGCCTTGG + Intronic
1182020645 22:27078920-27078942 CAGGAAGGTAGTGTTGGTCAAGG - Intergenic
1182432742 22:30309965-30309987 CAGGGAGTGAGGCTTGGAGGAGG - Intronic
1182686513 22:32124317-32124339 CAGGAATGGAGGCATAGCCAGGG + Intergenic
1183304345 22:37074321-37074343 CTGGAAGGCTGGCTGGGACAGGG + Intronic
1184039376 22:41934007-41934029 CAGGCAGTGGGGCTTGGAGAGGG + Intergenic
1184056340 22:42052794-42052816 GAGACAGGGAGGCTGGGACAGGG - Intronic
1184093097 22:42302525-42302547 CAGGAGAGGAGGCTTTGCCAAGG + Intronic
1184160363 22:42693931-42693953 GAGGTCGGGGGGCTTGGACATGG + Exonic
1184339247 22:43877008-43877030 CAGGCAGGGAGGCTTGTAGCAGG + Intergenic
1184368396 22:44067502-44067524 CACGAAGGAAGGCTGGGGCAAGG - Intronic
1184390554 22:44200969-44200991 CAGGAAGGGAGGAGGGGACGTGG - Intronic
1184421397 22:44384735-44384757 CGGAGAGGGTGGCTTGGACAAGG + Intergenic
1184889324 22:47369854-47369876 CACGAAGGGAAGGGTGGACAGGG - Intergenic
1184914394 22:47559186-47559208 GAGGAGGTGAGGATTGGACACGG + Intergenic
949230653 3:1746040-1746062 TAAAAAGGGAGACTTGGACATGG - Intergenic
949355843 3:3179698-3179720 CCGCAAAGGAGGCTGGGACAGGG + Exonic
949901825 3:8821498-8821520 CAGGAAGGCAGGCAGGGACCAGG - Intronic
949995519 3:9613520-9613542 CTGGAAGGGAGCATTGCACAAGG - Intergenic
950969266 3:17170202-17170224 CAGCACCGGATGCTTGGACAGGG + Intronic
951247912 3:20362527-20362549 GAGGAGGTGAGGCTTGAACAAGG - Intergenic
951894782 3:27600430-27600452 AAGAAAGAGAGGCTGGGACAAGG - Intergenic
952327583 3:32335103-32335125 CAAGTAGGGAGGCCTGGCCAGGG + Intronic
952552233 3:34492491-34492513 CAGGAAGTCATGCTTAGACAAGG + Intergenic
953406167 3:42660858-42660880 CAGGGATGGAGGCTAGGCCAAGG - Intronic
953420372 3:42749405-42749427 GAGAAAATGAGGCTTGGACAGGG - Intronic
953665112 3:44920240-44920262 CAAGAAGGGAGGCCTGGCGAGGG - Intronic
954035595 3:47849379-47849401 CAGGGAAGGAGGCTGGGACCTGG - Intronic
954713822 3:52517396-52517418 CAGCATGGCAGGGTTGGACATGG + Intronic
954787026 3:53101278-53101300 CAGGAAGGGAGGCGGGGACCAGG + Intronic
955067077 3:55543067-55543089 CAGGAAGGCAGGCCAGGAGAAGG - Intronic
955473024 3:59306392-59306414 CAGAAAGGCTGGCCTGGACAGGG + Intergenic
955554549 3:60121837-60121859 CAGAAAGGGAGGCTTGGAGAAGG - Intronic
956559088 3:70553637-70553659 AAGTAAGGGAGGCTTGGGGACGG - Intergenic
958025653 3:88045842-88045864 AAGGAAAGAAGGCTGGGACAGGG + Intergenic
959389859 3:105759900-105759922 CAGTAGGGGAGGCATGGCCAGGG - Intronic
959850108 3:111075329-111075351 GAGGAAGGGAGGGAAGGACAGGG - Intronic
961034416 3:123632425-123632447 AAGGAAGGGAGGTTTGCAGAAGG - Intronic
961494969 3:127284695-127284717 CAGGAAGGGAGACCAGGAGAGGG + Intergenic
961514388 3:127423633-127423655 CAGGAAGAGAGACTTTGAAAGGG - Intergenic
962991776 3:140583901-140583923 CAGGAATGGTAGCTTTGACAAGG - Intergenic
963881656 3:150535217-150535239 CAGGAAGGAAGGCTGGGCAAAGG + Intergenic
964371931 3:156009021-156009043 GAGGAAGGGAGAATTGGACGGGG + Intergenic
965623285 3:170661944-170661966 CAGGAAGGGAGGCTTGGAGGGGG + Intronic
965908178 3:173736601-173736623 TTAGAAGGGAGGCTTGGAGAGGG + Intronic
966017071 3:175153495-175153517 CAGAAAGGGACCCATGGACAAGG - Intronic
966470894 3:180287821-180287843 AAGGAAGGGAGGGTAGGAAAAGG - Intergenic
966639386 3:182172819-182172841 CAGGAATGGGAGTTTGGACAGGG + Intergenic
966839614 3:184077938-184077960 CAAGAAGGGAGTCTTGGCCCAGG + Intergenic
967241940 3:187448085-187448107 CAGGCAGGCAGGCTTGGATGGGG - Intergenic
967728561 3:192884771-192884793 GAGGAAGGCAGGCGTGGAAAGGG - Intronic
968574775 4:1360500-1360522 CAGGAGGCCAGGCCTGGACAAGG - Intronic
968591665 4:1462724-1462746 AAGGAAAGGAGGCTTGGAGAAGG + Intergenic
968616399 4:1579452-1579474 CAGGACGCGGGGCTGGGACAAGG - Intergenic
968631913 4:1656258-1656280 CAGGAAGTGAGACTTGGGAAGGG - Intronic
969354881 4:6619516-6619538 GTGTAAGGGAGGCTGGGACAAGG + Intronic
969616060 4:8253180-8253202 CAGGAAGGGAGGGAGGGAAAAGG - Intergenic
970318599 4:14853661-14853683 CAGCAAGGGAGCCTGGGAAATGG - Intergenic
970367139 4:15371414-15371436 GAGCAAGGGAGGATTAGACAGGG - Intronic
972106332 4:35493891-35493913 CAGTGAGGGAGGCGTGGCCAGGG + Intergenic
972736671 4:41848742-41848764 GAGGATAGGAGGCTTGGTCAAGG + Intergenic
972897429 4:43640690-43640712 CAGCAAAGGAGGCATGGACATGG + Intergenic
974591548 4:63954422-63954444 AAGTAGGGGAGGCTTAGACAAGG - Intergenic
974838083 4:67274467-67274489 CAGGAGGGGAGGCAAGGGCAAGG + Intergenic
976728957 4:88243984-88244006 CAGGGAGGGAGGCATAGCCAGGG + Intergenic
977350337 4:95876596-95876618 CAGAAAAGGAGGCTTGGAGAAGG + Intergenic
978331536 4:107618527-107618549 CAGGGAGAGGGGCTTTGACAAGG + Intronic
978663550 4:111155166-111155188 CAGCAGGGGAGGCCTGGCCAGGG - Intergenic
979611592 4:122694812-122694834 CAGGTAGGGAGGAAAGGACATGG + Intergenic
979678587 4:123435465-123435487 AAGGGAGGGGGGCTTGGGCATGG + Intergenic
979734084 4:124060909-124060931 AAGGAAGGGAGGAATGGACAGGG - Intergenic
980186087 4:129462880-129462902 CAGGAAGGGAGGACAGCACAAGG + Intergenic
980900930 4:138904527-138904549 CAGGAAGGGAGGCTGGGAGCAGG - Intergenic
980973660 4:139589844-139589866 CAGGAAGCAAGGCTTGACCAAGG - Intronic
985705744 5:1400521-1400543 CAGGAGGGGAGGCCTGGGCCTGG - Intronic
986644023 5:9898803-9898825 CAGGCAGAGGGGCCTGGACAGGG + Intergenic
987047572 5:14122303-14122325 CATGAAGGGAGGCTTGGGGATGG + Intergenic
989543500 5:42645644-42645666 CAGGAAGAGTGGCATGGACATGG - Intronic
989726584 5:44594624-44594646 CAGAAAGGAAGACTTGGACTGGG + Intergenic
990596276 5:57315325-57315347 AAGGAAGGCAGGATTGGAGAGGG - Intergenic
991411062 5:66346356-66346378 AAGGAAGGGAGGGAGGGACAGGG - Intergenic
992204499 5:74417894-74417916 CAGGAAGGTGGGGTTGGACTGGG - Intergenic
994316522 5:98339515-98339537 CAGGAAGGAAGGCTGGAAGAGGG - Intergenic
995349248 5:111156232-111156254 AAGGCAGGAAGGCTTTGACATGG - Intergenic
996176710 5:120368409-120368431 CAGGGAGGGAGGCTGGGGTAGGG + Intergenic
996558574 5:124803942-124803964 CAGGAAGGAAGGGTGGGAGAAGG + Intergenic
996915801 5:128711051-128711073 CAGGAAAGGAGGCTTTAACCAGG - Intronic
997387832 5:133487640-133487662 CAGTAAAGGAGGGTTGGCCATGG + Intronic
999267568 5:150276797-150276819 GAGGAAGGGATGGTTGGACGGGG + Intronic
999383848 5:151140453-151140475 AAGGGAGGGGGGCTTGGCCAAGG + Intronic
999621211 5:153476273-153476295 CAGGAAAGGATTCTTGGAAAAGG - Intergenic
999809599 5:155115067-155115089 GAGGAGGGGAGGCTTGGGCATGG - Intergenic
999820550 5:155223613-155223635 CAGGAAGGAAGACTTGTAGATGG + Intergenic
1000942900 5:167384282-167384304 CAGTAAGGGAAGCTTTGAGAAGG + Intronic
1001125911 5:169019044-169019066 CAGGAAGGAAGCCTTGTACAGGG + Intronic
1001270522 5:170308004-170308026 AAGGAAGTTATGCTTGGACAGGG - Intergenic
1001831633 5:174793964-174793986 CAGGGAGGGAGGCTTAGTCCCGG + Intergenic
1002168490 5:177362459-177362481 CAGGGAGAGAGGCCGGGACATGG + Intronic
1002764158 6:225365-225387 CAGGAAGTGGGGCCTGGACCGGG - Intergenic
1003716987 6:8658587-8658609 CAGGAAGGGAGTCCTGGTCGTGG + Intergenic
1005205654 6:23401274-23401296 CAGGAAATGAGGGTGGGACAGGG + Intergenic
1005825012 6:29627470-29627492 CAGCAAGGTAGCCCTGGACATGG - Exonic
1006418517 6:33919317-33919339 CAGGGAGGGAGGAGGGGACAAGG - Intergenic
1007785758 6:44278293-44278315 GAGAGAGGGAGGCTTGGGCAGGG + Exonic
1007951314 6:45875047-45875069 CATGAAAGTAGGCTTAGACAGGG - Intergenic
1008251865 6:49249930-49249952 CAGGAATAGATGGTTGGACAAGG + Intergenic
1008485814 6:52034328-52034350 CAGGAAGGGGGACTTGAAGAAGG + Intronic
1009241824 6:61194005-61194027 CAGCAGGGGAGGCATGGCCAGGG - Intergenic
1010014016 6:71083356-71083378 CAGGATGGGAGTAGTGGACATGG + Intergenic
1011122975 6:83974790-83974812 CAGACAAGGAGGCTTGCACAGGG - Intergenic
1011290517 6:85772289-85772311 CAGTAAGGGATGATTGCACAGGG + Intergenic
1011848013 6:91590427-91590449 CAGGCAGGGAAGCTTGAACTGGG + Intergenic
1012507280 6:99961706-99961728 CGGGATGGGAGGCTGGGAGAGGG + Intronic
1013383088 6:109596669-109596691 CAGGAAGGGAGGGGTGGCTAAGG + Intronic
1014001071 6:116367108-116367130 CAGGGAGGGAGGCCTGAGCAAGG + Intronic
1014595891 6:123338296-123338318 GAGAATGGGAGGCCTGGACAGGG + Intronic
1020612623 7:10419373-10419395 CAGGGAGGGAGGATAGGACCTGG - Intergenic
1021083502 7:16391373-16391395 GAGGATGGGTGGCTTGGACTTGG - Intronic
1021328588 7:19305729-19305751 CAGAAAGTGAGGCTTGGAGATGG + Intergenic
1021399993 7:20198599-20198621 CCAGAATGGAGGCTTGGACCAGG - Intronic
1022245864 7:28558675-28558697 GAGAAAGGGGGGCTTGGGCAAGG + Intronic
1022309862 7:29186612-29186634 CAGGAAGGGAGGGAGGGAGAGGG + Intronic
1022486928 7:30786174-30786196 CAGGAAAGGAGGCCTGCTCAAGG - Intronic
1022977804 7:35574994-35575016 GAGGACGGGAGGCCTGGACTTGG - Intergenic
1023596015 7:41829989-41830011 CAGGAAGGGAGGTAGGGGCAGGG + Intergenic
1026011482 7:66639623-66639645 AAGGGAGGGACGCTTGAACAGGG - Exonic
1026045753 7:66904367-66904389 GAGGAAGGGAGCCTTGGGCTGGG - Intergenic
1026557319 7:71419763-71419785 CATGAGTGGAGGCTTGGCCAGGG + Intronic
1026617501 7:71918814-71918836 AAGGAAGGAAGACTTGAACATGG - Intronic
1026739495 7:72969795-72969817 CAGGGAGGGCAGCTAGGACATGG + Intergenic
1026790514 7:73328410-73328432 CAGGGAGGGCAGCTAGGACATGG + Exonic
1027104237 7:75395278-75395300 CAGGGAGGGCAGCTAGGACATGG - Intronic
1030087920 7:105832922-105832944 CAGAAAGGGAGGCTTGTGCTGGG - Intronic
1030265428 7:107616099-107616121 CAGCAAGGGAGCCTTGGAAACGG - Intronic
1031004499 7:116456669-116456691 CAGGAAGGGGGGTTGGGGCACGG - Intronic
1032232919 7:130091650-130091672 TAGGAAGGGAGGCTGAGAGAAGG - Intronic
1034345405 7:150382485-150382507 CAGGAAGGGTGGCCTTGAGAAGG + Intronic
1034350298 7:150410910-150410932 AAGGGAAGGAGGCTTGGCCAGGG - Intronic
1034598547 7:152224078-152224100 CAGGAAGATAAGCTTGCACAAGG + Exonic
1035255374 7:157622523-157622545 GAGGGAGGGAGGGCTGGACACGG + Intronic
1035636967 8:1154992-1155014 CAGGATGGGAGGGAGGGACAAGG - Intergenic
1036685155 8:10904624-10904646 CAGGAAGGGAGGCTGTGACCGGG + Intronic
1037389780 8:18381093-18381115 CAGGAAGGGAGGGATGGGCTTGG + Intergenic
1037873404 8:22521469-22521491 TAGGAAGGGCTGCTTGGAGAAGG - Intronic
1038671826 8:29589202-29589224 CAGGAAGGAGGGCTTGGTCCTGG - Intergenic
1039253941 8:35697978-35698000 GAGGTAGGGAGGTTTGGAGAGGG - Intronic
1039972469 8:42331807-42331829 CAGGAATGGAGACATGGGCATGG - Intronic
1040000905 8:42575473-42575495 GAAGGAGGGAGGCTTGGGCATGG - Intergenic
1040003670 8:42600161-42600183 GAGGAGGGGTGGCTTGGGCATGG + Intergenic
1041255593 8:55977571-55977593 CAGGAAGGGTGGGATGGAAAAGG + Intronic
1042883740 8:73524207-73524229 GAGGAAGAGATGCTGGGACAAGG + Intronic
1045197347 8:99945017-99945039 CAGGAAGGGGGGTTGGGGCATGG - Intergenic
1045379622 8:101610382-101610404 CAGGAAGGAGGGCTTGAACTGGG + Intronic
1045517588 8:102873920-102873942 CAGGAAGGAAGACTTGAAGAGGG + Intronic
1046647686 8:116803814-116803836 GAGGATGGGAGGGCTGGACACGG - Intronic
1047329066 8:123868624-123868646 CAGGGAGGGCTGCTTGGAGAAGG - Intronic
1047926427 8:129687299-129687321 CAAGAAGGGAAGCATGGACCTGG + Intergenic
1048238408 8:132715994-132716016 CAGCAGGGGAGGCCTGGCCAGGG + Intronic
1048476904 8:134751743-134751765 TAGAAAAGGAGGCCTGGACATGG + Intergenic
1048608804 8:135999634-135999656 AAGGAAAGGAGGCTAGGACCAGG - Intergenic
1049268437 8:141681735-141681757 GAGGAAGGGAGTCTGGGGCAGGG + Intergenic
1049606652 8:143532736-143532758 CAGGCAGGCAGGCATGGAGACGG + Intronic
1050156238 9:2669124-2669146 CAGAAATGGAGGCATGGAGATGG - Intergenic
1050589834 9:7149537-7149559 CAGCGAGGGAGGCATGGCCAAGG - Intergenic
1051522793 9:18008964-18008986 AAGGAAGAGAGGACTGGACATGG + Intergenic
1052954531 9:34243240-34243262 GAGGAAGGGAGTGTTGGCCAAGG - Intronic
1052970451 9:34374059-34374081 CAGGAAGGCAGGCATGGAAATGG - Intronic
1052992907 9:34532207-34532229 CAGGAAGGGAAGCTTGAACTGGG - Intergenic
1053487252 9:38469277-38469299 CAGGACAGGAGGAATGGACAAGG - Intergenic
1053722063 9:40956435-40956457 CAGGAAGGGAGGCATCTGCAAGG + Intergenic
1054343908 9:63895538-63895560 CAGGAAGGGAGGCATCTGCAAGG - Intergenic
1055988336 9:82077572-82077594 CATGAATGGAGGCTAGAACAAGG + Intergenic
1056715142 9:89022273-89022295 CAGGAAGGGAGGGTTGGGGGAGG + Intronic
1058166236 9:101622394-101622416 CAGGAAGGGAAGCTGGGAATTGG + Intronic
1059458378 9:114413906-114413928 CAGGGAGGGAGGCGTGGAGCAGG - Intronic
1059556060 9:115281666-115281688 CAGGAATGGAGGATTTGACATGG - Intronic
1060427329 9:123517328-123517350 CAGGAAGGGAGGGCCGGGCATGG + Intronic
1060512034 9:124241235-124241257 CAGGAAGAGAGGCTCAGCCAAGG + Intergenic
1060533667 9:124365401-124365423 CAGGAAGAGAGCCATGAACATGG + Intronic
1060677454 9:125528383-125528405 CAGGCAGGGAGAAGTGGACAGGG - Intronic
1060745624 9:126129058-126129080 CAGCAAGGGAGGCTTGGTAGGGG - Intergenic
1061799629 9:133106815-133106837 TAGGAGGGGAGGCTTGGCCAAGG - Intronic
1062062349 9:134503205-134503227 CAGGCAGCGTGGGTTGGACATGG - Intergenic
1062174180 9:135151764-135151786 CAGGCAGGGAGGCCAGGCCAAGG - Intergenic
1062185743 9:135217603-135217625 GAGGGAGGGAGGCTGGGAGAAGG - Intergenic
1062245510 9:135563976-135563998 CAGGCAGGGAGGCTGTGACCTGG - Intronic
1062355166 9:136158427-136158449 CAGGAAGAGAGGCCTGGAGGTGG + Intergenic
1062465335 9:136678317-136678339 CATGACGGGCTGCTTGGACAAGG - Intronic
1062706898 9:137950566-137950588 CTGGAAGGGAGGGATGGAGATGG + Intronic
1203453107 Un_GL000219v1:139523-139545 CAGGAAGGGAGGCATCTGCAAGG - Intergenic
1185457138 X:316870-316892 CAGGAAAGGAGGTTTGGGGAAGG + Intronic
1185814592 X:3143309-3143331 CAGGAAGTGTGTCTTGCACAGGG + Intergenic
1185934469 X:4240171-4240193 CAGGAAGTGTGTCTTGCACAGGG + Intergenic
1186211628 X:7256142-7256164 CAGGCAGGGAGGAATGGACCTGG + Intronic
1186388439 X:9133613-9133635 CAGGCAGAGAGGCTTCTACAGGG - Intronic
1187327868 X:18308337-18308359 CAGGGAGGGAGGAAAGGACAGGG + Intronic
1188647741 X:32591642-32591664 CAGCAAGGGAGGCGTGGCCAGGG + Intronic
1189719388 X:43899747-43899769 CAGTAATGGAGGCTGGGAAAAGG + Intergenic
1190064600 X:47231320-47231342 CAGCAAGGGAGGATGGGAAAAGG + Intergenic
1190118273 X:47639641-47639663 GACAAAGGGAGGCTTGGAAAGGG - Intronic
1191701395 X:64046368-64046390 CAGGTAGTGAGGCTTGGTAATGG + Intergenic
1191928680 X:66344430-66344452 GAGGATGGGAGGTTTGGACTGGG - Intergenic
1193348201 X:80428931-80428953 GAGGAAGGGAGGCCTGGACTGGG + Intronic
1195804093 X:108743162-108743184 AAGGAAGGGAGGGAGGGACAAGG + Intergenic
1195913838 X:109916157-109916179 TAGAAAAGGAGGCTGGGACAGGG + Intergenic
1197746667 X:129936106-129936128 CAGGAAGGGAGGAAAGGAGAGGG - Intergenic
1200424982 Y:3010072-3010094 CAGCAGGGGAGGCGTGGCCAGGG - Intergenic
1201266605 Y:12212919-12212941 CAGGAAGTGTGCCTTGCACAGGG - Intergenic
1201514844 Y:14808778-14808800 CAGGAAGGGATGCTCAGGCAAGG + Intronic
1201718956 Y:17076564-17076586 CAGGAAGAGTGGCATGCACAGGG - Intergenic