ID: 903960937

View in Genome Browser
Species Human (GRCh38)
Location 1:27057450-27057472
Sequence AGGAAGGGAGGCTTGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903960926_903960937 19 Left 903960926 1:27057408-27057430 CCTGCACTTTTGTGTGGCTGCAT No data
Right 903960937 1:27057450-27057472 AGGAAGGGAGGCTTGGACAGGGG No data
903960930_903960937 -7 Left 903960930 1:27057434-27057456 CCACGGGCAGCATCTCAGGAAGG No data
Right 903960937 1:27057450-27057472 AGGAAGGGAGGCTTGGACAGGGG No data
903960923_903960937 27 Left 903960923 1:27057400-27057422 CCCTGGAGCCTGCACTTTTGTGT No data
Right 903960937 1:27057450-27057472 AGGAAGGGAGGCTTGGACAGGGG No data
903960924_903960937 26 Left 903960924 1:27057401-27057423 CCTGGAGCCTGCACTTTTGTGTG No data
Right 903960937 1:27057450-27057472 AGGAAGGGAGGCTTGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903960937 Original CRISPR AGGAAGGGAGGCTTGGACAG GGG Intergenic
No off target data available for this crispr