ID: 903965483

View in Genome Browser
Species Human (GRCh38)
Location 1:27086440-27086462
Sequence ACAAAAGGCAGGAATCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903965479_903965483 12 Left 903965479 1:27086405-27086427 CCGTCAAGGGGAGGGGATTATAC No data
Right 903965483 1:27086440-27086462 ACAAAAGGCAGGAATCTTGGAGG No data
903965476_903965483 20 Left 903965476 1:27086397-27086419 CCTGTATACCGTCAAGGGGAGGG No data
Right 903965483 1:27086440-27086462 ACAAAAGGCAGGAATCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903965483 Original CRISPR ACAAAAGGCAGGAATCTTGG AGG Intergenic
No off target data available for this crispr