ID: 903968463

View in Genome Browser
Species Human (GRCh38)
Location 1:27103818-27103840
Sequence TGTTAAATAGAGACAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903968463_903968465 -7 Left 903968463 1:27103818-27103840 CCTTCCATTGTCTCTATTTAACA 0: 1
1: 0
2: 1
3: 23
4: 290
Right 903968465 1:27103834-27103856 TTTAACAGATGCAGAAACTGAGG 0: 2
1: 61
2: 735
3: 3926
4: 10851
903968463_903968466 3 Left 903968463 1:27103818-27103840 CCTTCCATTGTCTCTATTTAACA 0: 1
1: 0
2: 1
3: 23
4: 290
Right 903968466 1:27103844-27103866 GCAGAAACTGAGGCTCAGAGAGG 0: 7
1: 166
2: 1127
3: 3800
4: 8328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903968463 Original CRISPR TGTTAAATAGAGACAATGGA AGG (reversed) Intronic
901618359 1:10560355-10560377 TGTTAAATATAAAAGATGGAAGG - Intronic
903927554 1:26841432-26841454 TGCTAAATAAATAAAATGGAAGG - Intronic
903968463 1:27103818-27103840 TGTTAAATAGAGACAATGGAAGG - Intronic
905485192 1:38291162-38291184 TGTTAAAAAAAGAAAAAGGAAGG - Intergenic
906782382 1:48584236-48584258 TCTTGAATGTAGACAATGGAAGG - Intronic
908481995 1:64549926-64549948 TTTTAAATAGAGGCAATGTATGG + Intronic
909791896 1:79690064-79690086 TTTTATATAGAGAAAATGAAGGG + Intergenic
910225783 1:84934646-84934668 TGTAAAATGGGGACAATGCAAGG + Intronic
910789134 1:91032967-91032989 TTTTAAAGAGAGAGCATGGAAGG + Intergenic
911775660 1:101808634-101808656 TGATTAATACAGACATTGGAGGG + Intronic
915812560 1:158930228-158930250 AGTTAAAGACAGAAAATGGAGGG + Intergenic
916225517 1:162486397-162486419 TGTAAAATAGTGACAAGTGATGG + Intergenic
916772741 1:167928376-167928398 TGTTAATTAGCTACAATGAAAGG - Intronic
917214935 1:172668618-172668640 TGTTAAAAAGGGACAAGGAAGGG - Intergenic
919213699 1:194522283-194522305 TGATAAAGAGAGAGAATGGATGG + Intergenic
919290089 1:195619108-195619130 AGATAAATAGAGACACTGAAGGG - Intergenic
919604418 1:199663810-199663832 TGTCCAAGAGAGACAATGGAAGG - Intergenic
919844480 1:201632751-201632773 TGATATATAGAGAGAATGGGTGG + Intronic
920591883 1:207227837-207227859 TGTTAAATGGAGACAGTGTGGGG - Intergenic
920877856 1:209854182-209854204 TCTGAAATATAGACAAAGGATGG + Exonic
920877976 1:209855040-209855062 TTTTAATTAGAGTCAATGAATGG + Exonic
923174636 1:231452732-231452754 TGGTAAAAAGAGACAAAGAAGGG + Intergenic
1063333452 10:5185741-5185763 TTCTAAAAAGAGACAATGGCTGG - Intergenic
1063816344 10:9778309-9778331 TGTAGAATTGAGACACTGGAAGG + Intergenic
1064181407 10:13119409-13119431 TTGTATATATAGACAATGGAAGG - Intronic
1068273488 10:54760648-54760670 TGATAAATAAACACAAAGGATGG - Intronic
1068484606 10:57641437-57641459 TGTTAAAAACAGGAAATGGAAGG - Intergenic
1069089020 10:64176818-64176840 TGTAAAATAGAGATAATGATAGG + Intergenic
1069455713 10:68552222-68552244 TGTCAAAAAGAGAGAAAGGAAGG + Intergenic
1069997345 10:72350814-72350836 TGTGAAATACAGTGAATGGAAGG + Intronic
1070004367 10:72408859-72408881 TTTTAAATTGAGATAATGAACGG - Intronic
1070923634 10:80204611-80204633 TGTTACCTAGAGACTTTGGAGGG - Intronic
1071581550 10:86776012-86776034 AGAAAAAGAGAGACAATGGAAGG - Intronic
1072267766 10:93746882-93746904 TGATCAACAGAGACAATGTATGG + Intergenic
1072942857 10:99782650-99782672 TGTTACATTGAAACAGTGGATGG - Intergenic
1074796189 10:116947204-116947226 TGTTAAATAGTGATAATGACAGG + Intronic
1076159347 10:128231048-128231070 TGTTGAATAGAGGTAATGAAGGG + Intergenic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1078333628 11:10446130-10446152 TGTTGAACTGAGGCAATGGAAGG + Intronic
1078333797 11:10448096-10448118 TGTTGAACTGAGGCAATGGAAGG - Intronic
1078943998 11:16043395-16043417 TGTTAAATATATACATTGTAGGG - Intronic
1080545395 11:33312212-33312234 TGTCTAATAAAGAAAATGGAAGG - Intronic
1081260931 11:40959656-40959678 TTAAAAATAGAGAAAATGGAAGG - Intronic
1082219207 11:49612787-49612809 TGGGAAAAAGAGAAAATGGAGGG - Intergenic
1084766686 11:71313811-71313833 GGTTAAATACAGACATTAGAGGG + Intergenic
1084879895 11:72163421-72163443 TGTTAAAACGAAACAAGGGAGGG + Intergenic
1085333179 11:75669343-75669365 TGTAAAATAGGGCCAATGGGGGG + Intergenic
1086630453 11:89012090-89012112 TGGGAAAAAGAGAGAATGGAGGG + Intronic
1087219865 11:95535260-95535282 TGTAAAATACAGCCAGTGGAAGG + Intergenic
1087683893 11:101241954-101241976 TGTTAAATAGAGACACAGTGGGG + Intergenic
1088061889 11:105663523-105663545 ACTTAAATAGAGACAATGACAGG + Intronic
1088381567 11:109199069-109199091 TTTTTAATGGAGAGAATGGAAGG - Intergenic
1088785701 11:113179874-113179896 GGTTAATAAGAGACAGTGGATGG + Intronic
1089115814 11:116094194-116094216 TGTTGAAGAGAGAAAATGGCAGG - Intergenic
1089565634 11:119369864-119369886 TCTTAAATAGGTACAATGGGAGG - Intronic
1090085151 11:123644022-123644044 TTTGTAACAGAGACAATGGAAGG - Intronic
1090286144 11:125501232-125501254 TTTGAAAGAGAGAAAATGGAAGG - Intergenic
1093156549 12:15692951-15692973 TGTCATAAAGAGACAATGAAGGG - Intronic
1094279580 12:28720759-28720781 TGTTACACAGAGACAGGGGATGG - Intergenic
1094436045 12:30422079-30422101 GGCTAAATAGAAACAATGTAAGG - Intergenic
1096120695 12:49087847-49087869 TGATAAAAAGAGACAAGGGCAGG + Intergenic
1096602459 12:52739235-52739257 TTTTAAATATGGACAAAGGATGG + Intergenic
1099986538 12:89672157-89672179 TGTAAAATAGAGAAACTGGCTGG + Intronic
1100204507 12:92333536-92333558 TCTTAAAGAGAGAGCATGGAGGG - Intergenic
1100910336 12:99353706-99353728 TGTTTCATAGAGGAAATGGATGG - Intronic
1103127413 12:118435941-118435963 TGTTTAATAGAGATAGGGGATGG + Intergenic
1103838966 12:123847270-123847292 TGATAAATAGACAGGATGGATGG - Intronic
1105476888 13:20735758-20735780 GAGTAAATAGAGACTATGGAGGG + Intronic
1106110020 13:26768688-26768710 TCTTGAAAAGAGAAAATGGAAGG + Intergenic
1106516000 13:30454496-30454518 TGTTATATATAGAAACTGGAAGG + Intergenic
1106902073 13:34363977-34363999 TGTGAAATGGAGAGAATGTAAGG + Intergenic
1107987566 13:45788430-45788452 AGTTAAACACAGCCAATGGAAGG - Intronic
1108322997 13:49304870-49304892 TGACAAATAGAGCCAAGGGAAGG + Intergenic
1109531790 13:63659386-63659408 TGTTAAATAGAAATAATGTCAGG + Intergenic
1109587984 13:64435432-64435454 TGATAAATAGAGAAAATAAAAGG - Intergenic
1110721480 13:78767145-78767167 TGTAAAATAAAGACAAGGCATGG + Intergenic
1110976848 13:81848492-81848514 TGTTACACAGAGAAAAGGGATGG + Intergenic
1112629495 13:101145336-101145358 TTGTAAAGAGAGACAATGGCAGG + Intronic
1112858823 13:103805596-103805618 TGTATAATAGAGACAAGGCATGG + Intergenic
1113641484 13:111960644-111960666 TGATAGATAGAGAGGATGGATGG + Intergenic
1114233663 14:20805477-20805499 TGCTATATAGAGACAATGAAAGG + Intergenic
1114897810 14:27013599-27013621 TGTTAAATAAAAACAATGTTAGG - Intergenic
1115012487 14:28566330-28566352 TGTTAAAGAGAGAGAGAGGAGGG - Intergenic
1116201235 14:41799905-41799927 TATGAATTAGAGTCAATGGAGGG + Intronic
1116231181 14:42218953-42218975 AGTTAAAGAGTGACAATGAAGGG - Intergenic
1116371456 14:44138932-44138954 TGTTAAATAGATATATTGTATGG + Intergenic
1116409866 14:44608537-44608559 TGAAAAATAGAGACAATGGCTGG - Intergenic
1118328819 14:64800290-64800312 TGTTTAGTAAAGACAATGGCTGG - Intronic
1118657677 14:67969489-67969511 TGCTAAACAGAAGCAATGGAGGG - Intronic
1119677084 14:76563844-76563866 TGTTAAATAGATAGATTGAAGGG + Intergenic
1120262171 14:82199540-82199562 TGTGCAATAGAGACAATGAGTGG - Intergenic
1121371827 14:93365801-93365823 TTTCAGATAGAGAAAATGGAAGG + Intronic
1122116759 14:99531563-99531585 AGTTAAATAGAGGCCATGGGTGG + Intronic
1123962834 15:25424167-25424189 TGGGAAATAGAGAGAATGGAGGG - Intronic
1126254633 15:46611501-46611523 TTTTAAATAGAGAGAAAGTAAGG - Intergenic
1126577238 15:50209275-50209297 TGTTCAAAAAAGAGAATGGATGG + Intronic
1126861285 15:52885447-52885469 AGTGAAATAGAGACAGTTGAAGG - Intergenic
1128708437 15:69854342-69854364 CTTTAAATAGAGAGAATAGAAGG + Intergenic
1129687306 15:77694176-77694198 TGTTACAGAGAGTCAAGGGAAGG + Intronic
1130455599 15:84103781-84103803 TGTTAAACAGTGACAAGAGATGG + Intergenic
1131496403 15:92915089-92915111 TGTTAAACAGAATCTATGGAAGG - Intronic
1131540864 15:93274125-93274147 TGTCAAATACAGACAATGACTGG - Intergenic
1134185395 16:12081103-12081125 TGTAAAATGAAGACAGTGGAAGG + Intronic
1134293964 16:12928370-12928392 TGTAAAATGCAGACAATGGATGG - Intronic
1136539738 16:30922769-30922791 TCTCAAGTCGAGACAATGGAAGG - Intergenic
1137926937 16:52548531-52548553 CGTTAAATGGAGACTAGGGAGGG - Intergenic
1138047137 16:53736976-53736998 TGATAAATGGGCACAATGGAAGG - Intronic
1139154312 16:64422521-64422543 TGTAAAATGGAGACAATGTTAGG - Intergenic
1140016646 16:71193326-71193348 TGTTAAGTAGAAACATTGGAAGG - Intronic
1141434510 16:83992104-83992126 TGTTAAAAAGAGAGACTGGGGGG + Intronic
1144059162 17:11567075-11567097 TCTAAAATAAAGACAATGTACGG - Intergenic
1144115869 17:12089825-12089847 TTTAAAATGGAGACAATGCATGG - Intronic
1144381035 17:14698417-14698439 TGATAAAGAGAGGAAATGGAGGG + Intergenic
1148531868 17:48401007-48401029 TGAAAAAGAGAGACAATGGCCGG + Intronic
1148925123 17:51077415-51077437 TTTTAAATAGAGACAAGGCCAGG - Intronic
1151860146 17:76754873-76754895 TGTTAAACTGAGACAATGATAGG - Intronic
1152597469 17:81244863-81244885 TGAAAAACACAGACAATGGAGGG + Intergenic
1152670487 17:81601707-81601729 TTTTAAAAAGAGACACTAGATGG - Intronic
1152973214 18:185877-185899 TTTTAAGTAGAGACAAGAGATGG + Intronic
1153132465 18:1871630-1871652 TGTTAAAAAGAAAGAATGGAAGG + Intergenic
1153290457 18:3496943-3496965 TTTTAAAGAGAGACAAGAGAAGG - Exonic
1153704428 18:7731054-7731076 AGTTAAATAGATATGATGGATGG - Intronic
1154312090 18:13274757-13274779 TGTAAAATAGACACAATGTTGGG + Intronic
1155890049 18:31256440-31256462 TGTGAAATAGTGACTATGAAGGG - Intergenic
1155912950 18:31525783-31525805 TGCTTAATTGAGTCAATGGAGGG + Intronic
1156860920 18:41835449-41835471 TTTTAAAGATAGAGAATGGATGG - Intergenic
1157401345 18:47391066-47391088 TGTTAAATGGATGAAATGGATGG + Intergenic
1158763719 18:60422065-60422087 TTTTAAGTAGAGACAAGGTACGG + Intergenic
1159848068 18:73490073-73490095 TGTTATGGAGAGATAATGGAAGG - Intergenic
1159949206 18:74467889-74467911 TGGTATATACAGACAACGGAAGG - Intergenic
1159952825 18:74497073-74497095 TGTGAAATAGAGACAATATTTGG + Intronic
1159987584 18:74862165-74862187 TGTTAACTACAAATAATGGATGG + Intronic
1160320798 18:77892582-77892604 TGGTAAGTAGAGAAAATGCATGG + Intergenic
1162060950 19:8094839-8094861 CGCTAAATAGATACCATGGAAGG - Intronic
1162311535 19:9910570-9910592 TGTGGAATAAATACAATGGATGG + Intronic
1163347643 19:16753889-16753911 TGGAAGATAGAGACAATGGATGG - Intronic
1163347722 19:16754444-16754466 TGGAAAATAGAGATGATGGATGG - Intronic
1165765756 19:38350007-38350029 TGGTGAAGAGAGAAAATGGAAGG - Intronic
1166623967 19:44333354-44333376 TTTTAGATAGAGACAATACAAGG + Intronic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1166669310 19:44700573-44700595 TGATAAATAGAGATGATGGCCGG - Intronic
926585370 2:14680136-14680158 TTTTATACAGAGAAAATGGAGGG + Intergenic
928687613 2:33765039-33765061 CTTTAAATAGAGTCAATGGTAGG - Intergenic
928872186 2:35992967-35992989 TGAAAAGTAGAGACAATGGATGG - Intergenic
929874935 2:45788564-45788586 AGTAAATTAGAGGCAATGGAGGG - Intronic
932994861 2:76839137-76839159 TGTTAAAAAGAGACAAATTAAGG + Intronic
935968150 2:108502627-108502649 TCTTAAAGAGAGAGAATGTAAGG + Intronic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
938613159 2:132969972-132969994 TGAGAAAGAGAGAAAATGGAAGG + Intronic
940317351 2:152339062-152339084 TGGTTAATAAATACAATGGAGGG - Intronic
940362381 2:152810309-152810331 TGGTAAAAAGAGACAAAGAAAGG - Intergenic
940745178 2:157559814-157559836 TGTTAAACTGAGAAAATGCAAGG + Intronic
944478797 2:200133953-200133975 TTTTAAATAGAGAGAAGTGATGG - Intergenic
944722336 2:202436557-202436579 TTTTAAATTGAAACAATGCATGG + Intronic
945469430 2:210210626-210210648 TGATCAATAGAGACAGGGGAAGG - Intronic
945658122 2:212650730-212650752 TGTTAATAAGACACAATGGCCGG + Intergenic
945743891 2:213697169-213697191 TGTTAAATAGATTCAATCTAGGG - Intronic
946090552 2:217219002-217219024 TGTTCAGTAGAGACAAGGGCTGG + Intergenic
946147940 2:217744824-217744846 TGCTAAAAAGAGAAAAAGGAGGG + Intronic
1169434916 20:5578069-5578091 TGGTAAATAGAGACCAGGGCAGG - Intronic
1169537873 20:6565400-6565422 GGTTACAAAGAGACAATGGCGGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1169981467 20:11389480-11389502 CTTTAAATAGAGACAATGATGGG + Intergenic
1170152388 20:13239168-13239190 TATTAAATAGAAATAATGAAAGG + Intronic
1170197177 20:13701386-13701408 TATTAACTAGGAACAATGGATGG - Intergenic
1171564628 20:26169576-26169598 TGTTAAATGGAGACACTTTATGG + Intergenic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1173054760 20:39600442-39600464 AGATAGATAGAGATAATGGATGG - Intergenic
1174959311 20:55137026-55137048 TATTAAATAGAGACAATTTAAGG + Intergenic
1176036724 20:63043234-63043256 TGTGAAAAAAAGAAAATGGAGGG + Intergenic
1176870165 21:14077704-14077726 TTTTAAAAAGAAACAATGGGCGG + Intergenic
1177137379 21:17319692-17319714 AGTTAAAAAGAGACAAAGGAGGG + Intergenic
1177233679 21:18357478-18357500 GATTATATAGAGACAATGTAAGG - Intronic
1177879463 21:26674562-26674584 TGTTAAATTCAGCCAATGGGAGG + Intergenic
1177904853 21:26963227-26963249 TTTTAAATAGATACAAAGCAAGG - Intronic
1177960018 21:27652279-27652301 TGTTAAATGGAGACTAGGAAGGG + Intergenic
1178095644 21:29212306-29212328 GGTTAAATGGAGACTATGGAAGG - Intronic
1178218812 21:30631597-30631619 TCTTAAAAAGACACAATGAATGG + Intergenic
1183807629 22:40224984-40225006 TGTTGATTAGAAATAATGGATGG - Intronic
1183946746 22:41330638-41330660 GATTAAAAAGAGAGAATGGATGG + Intronic
1184093954 22:42306486-42306508 TGTCAAGTAGAGGTAATGGAGGG - Intronic
1185225835 22:49651714-49651736 TGAAAACTAGAGAAAATGGATGG + Intronic
949390904 3:3561133-3561155 GGTTAAGTAGACACAAAGGAAGG + Intergenic
949643209 3:6063378-6063400 AGTTAAATAAAGAGAATGTAAGG + Intergenic
950432827 3:12960896-12960918 TGTCAAATGGGAACAATGGAGGG - Intronic
951353363 3:21633897-21633919 GGTTAAATAGAGGAAATGGCTGG + Intronic
951406633 3:22307781-22307803 TCTTAAATACAGAAAATGTAAGG + Intronic
952724500 3:36569290-36569312 TGATCAAGAGAGACAATGAATGG + Intergenic
952881688 3:37989857-37989879 TGTTTAACAGACACAATGCAGGG - Intronic
953321702 3:41978409-41978431 TCTTAACAAAAGACAATGGATGG + Intergenic
953434444 3:42867489-42867511 TGTTAAGTAAAAACTATGGAAGG - Intronic
953474047 3:43191139-43191161 TATTAATTAGAAACAATAGATGG - Intergenic
953586982 3:44210541-44210563 TGCTCTATAGAGACAATGAAAGG + Intergenic
955602900 3:60667361-60667383 TGTTAATTAGAGATAAGAGAGGG - Intronic
955625513 3:60914420-60914442 TGTTCAGAAGAGAGAATGGAAGG + Intronic
955963770 3:64367155-64367177 GGTCAAATAGATAGAATGGAAGG - Intronic
957475072 3:80711812-80711834 AGTTCAAAAGAGACAAAGGAGGG + Intergenic
958915755 3:100048216-100048238 AGTAAAATAAAGACAGTGGAAGG - Intronic
959055994 3:101568226-101568248 TGTTGACTAGAGAAACTGGAAGG + Intergenic
959503086 3:107129426-107129448 AGTTAACCAGAGACACTGGAAGG - Intergenic
961062590 3:123844150-123844172 TATTAAACAGAGACAAAGCAAGG + Intronic
961776406 3:129289550-129289572 TTTTAAATAGAGACAAGGTCTGG + Intronic
962830212 3:139132749-139132771 TGTTGAAGAGAGATAATGGCAGG + Intronic
964785022 3:160386984-160387006 TTTTAAATGGATGCAATGGATGG + Intronic
965154915 3:165038595-165038617 TGTTCAATTGAAAAAATGGATGG + Intronic
965265724 3:166540104-166540126 TTTTAAATATAGACAATGTTAGG - Intergenic
966098773 3:176241143-176241165 TTATTAATAGAGACAGTGGAAGG + Intergenic
966384494 3:179381437-179381459 TGTTAAACAGCAACAATGGCAGG - Intronic
968218832 3:196918011-196918033 AGATAAATAGAAACAATGGCCGG + Intronic
968273062 3:197419635-197419657 TGTTTATTAGAGATAATAGATGG - Intergenic
969145156 4:5116107-5116129 TGTTTAATAGAGTCAATAAATGG - Intronic
970328521 4:14954537-14954559 AGTGAAATAGAGACAATGTTGGG - Intergenic
971312782 4:25540051-25540073 TGTTTAATAAAAACCATGGATGG + Intergenic
971739939 4:30506627-30506649 TGATAAATAGGGATAATGTATGG + Intergenic
972419139 4:38869815-38869837 TATGAAATAGTGACAGTGGATGG - Intronic
972915448 4:43872129-43872151 TTATAAATAGAGACAAAGAAAGG - Intergenic
973915307 4:55628150-55628172 TGTTAAAAAGAAAGTATGGATGG - Intronic
974227384 4:59064517-59064539 AGTGGAATAGAGACTATGGAGGG + Intergenic
975593614 4:76025184-76025206 TGAGAAATAGTGACAATGGAGGG + Intronic
975924737 4:79435375-79435397 TGGTAAATACAGTCAATGCATGG + Intergenic
976660457 4:87535243-87535265 TCTGAAATGGAGAAAATGGAAGG + Intergenic
978509874 4:109505014-109505036 ATATAAATAGAAACAATGGAAGG + Intronic
979657819 4:123217309-123217331 TGTTAAATAGAAAAGGTGGAGGG + Intronic
979981239 4:127257948-127257970 TCTTAAATGGAGATAATGGGAGG + Intergenic
980603866 4:135063829-135063851 TGTTAAATGTAGAAAATAGATGG - Intergenic
980617481 4:135249770-135249792 TGTTAACTACAGAAAATGAAAGG + Intergenic
981431520 4:144666869-144666891 TGTTAAATAGAGACAATAAAAGG + Intronic
981652250 4:147073334-147073356 TGTTTAAAAGGGACACTGGAGGG - Intergenic
981895243 4:149790759-149790781 TGTGAAATAGCGACAGAGGAGGG + Intergenic
982934888 4:161460655-161460677 TGTTAAATAGGCAAAATGAAGGG - Intronic
983523003 4:168730450-168730472 TAAGAAATAGAGACAATGCAGGG - Intronic
986335818 5:6754637-6754659 TGTTACATAGAGAGCAGGGATGG - Intronic
987128115 5:14834244-14834266 TGTAAAATGGAGACAATGACAGG + Intronic
988389240 5:30606061-30606083 TGGAAAATAGTGACAAAGGAGGG + Intergenic
992238854 5:74743875-74743897 TGTAAAATAGGGACAATATAAGG + Intronic
993029743 5:82692004-82692026 AGTTAAATAAAAACAAAGGAAGG + Intergenic
993675469 5:90810930-90810952 TCTTCAATATAAACAATGGATGG - Exonic
993692804 5:91023612-91023634 TCTGAAATAGAAACCATGGATGG - Intronic
994104109 5:95926536-95926558 TGCTAAAGAGGAACAATGGAAGG - Intronic
994225894 5:97250953-97250975 TGGTAAAAAGAGACTATGGTAGG + Intergenic
994244961 5:97468267-97468289 TGTTATATAGAGCCAATGAAGGG - Intergenic
995731424 5:115246576-115246598 TGTTAAATAGGAACACTAGATGG - Intronic
995789630 5:115871482-115871504 TGTGAAATTGAGATTATGGAGGG - Intronic
997674740 5:135704393-135704415 TGTTAAATATTGACTAGGGATGG + Intergenic
998910276 5:146952307-146952329 TGTCAAAAAGAGTGAATGGATGG - Intronic
1001136507 5:169107089-169107111 TGTTAATTAGAAGCAAAGGAAGG - Intronic
1003976502 6:11349970-11349992 AGTTTGAAAGAGACAATGGATGG + Intronic
1004784590 6:18953046-18953068 TGTAAAAAAGAAAGAATGGAAGG + Intergenic
1005231961 6:23712167-23712189 TGTAAAATAAAGATAATGAATGG + Intergenic
1005862461 6:29912036-29912058 TGTGAAATTGAGAGTATGGAAGG - Intergenic
1005885776 6:30096634-30096656 TGATAAAGTGAGACAATGCAAGG + Intergenic
1006067170 6:31470470-31470492 TGTGAGATAGAGAGTATGGAAGG + Intergenic
1007971969 6:46061039-46061061 TATTAAAGAGAGACATAGGAAGG + Intronic
1008839531 6:55884348-55884370 TGTAAAATGGAGATAATGGCAGG + Intergenic
1009600990 6:65799076-65799098 TGTTAAAAAGAGAGAATAGTGGG + Intergenic
1010627458 6:78155864-78155886 TGGTAAATTGAGATAATGAAAGG + Intergenic
1012063947 6:94523022-94523044 TGTAAAATTGTGACAATGTAGGG + Intergenic
1012383273 6:98646381-98646403 TGGTCAATAGATACAATGAATGG + Intergenic
1012497898 6:99854969-99854991 TGATATATAGAGAGAATGGATGG + Intergenic
1013044826 6:106474760-106474782 TGTGGAATGGAGACAAGGGAGGG + Intergenic
1013265242 6:108489950-108489972 TTTTCACTAGAGTCAATGGAAGG + Intronic
1013337568 6:109180459-109180481 TGTTCTATAGACACAATGAAGGG + Intergenic
1013768709 6:113602539-113602561 TGTTAAAAATAGATAATGAATGG - Intergenic
1021070980 7:16240129-16240151 TGTTGAATAGAAAGAATTGACGG - Intronic
1021642908 7:22757542-22757564 TGCTAAAAAGAGAACATGGAAGG + Intergenic
1023255781 7:38311127-38311149 TTTTAAATAGAGACATTTCAGGG - Intergenic
1023586249 7:41733024-41733046 GATTCAATAGAGACAAGGGAAGG - Intergenic
1027588744 7:80091090-80091112 TATTATATAGACAAAATGGATGG - Intergenic
1028378695 7:90175261-90175283 TCTTAAATAGAAACAATGGTGGG + Intronic
1030020767 7:105273245-105273267 TATAAAAAAGAGAGAATGGAGGG - Intronic
1030333564 7:108298762-108298784 TCTTGAAGAGAGACAAAGGAAGG - Intronic
1031274607 7:119703887-119703909 TGTTAAAAAGAAACAGTGGGAGG + Intergenic
1032277652 7:130473745-130473767 TGTTATACAGAGACAGTGGAAGG - Intergenic
1033059771 7:138095090-138095112 AGTAAAATAGGCACAATGGAAGG + Intronic
1033116441 7:138629999-138630021 TTTTAAATAGAGGCATTGGGAGG - Intronic
1033383361 7:140846284-140846306 TGGTAAATACATACAATGAATGG + Intronic
1034124408 7:148657983-148658005 TGTTAAATAACGACTATGTATGG + Intergenic
1035088717 7:156286069-156286091 TGTCAAATAGAGAGAAAGTAAGG - Intergenic
1037457999 8:19082958-19082980 TGTTAAAAAGAGAAAAGGGAAGG + Intronic
1042665230 8:71196784-71196806 TCTTAAAGAGAGACAGTGGTGGG - Intergenic
1043017446 8:74957848-74957870 TATTAAAAAGTGACAATGCATGG + Intergenic
1043430787 8:80193084-80193106 TGGTAAATAATGACAAAGGAAGG + Intronic
1044347826 8:91126693-91126715 TGTTCAAAAGAGAGAATGGAGGG + Intronic
1045859432 8:106798770-106798792 TGTCAAAGAGAAACAATGGATGG - Intergenic
1045910902 8:107408614-107408636 GTTTAAATAGTGATAATGGATGG + Intronic
1046368188 8:113265142-113265164 TGTTTAATTGAGACAAGGTATGG + Intronic
1046892064 8:119433098-119433120 TATTAAATGGAGACATTAGAAGG + Intergenic
1047447840 8:124935825-124935847 TTTTGAAAAGAAACAATGGAAGG + Intergenic
1047790229 8:128195885-128195907 TATAAAACAAAGACAATGGAAGG - Intergenic
1052284200 9:26766385-26766407 TGTAAAATGGAGACAATGCTAGG + Intergenic
1053510065 9:38680204-38680226 TTTTAAAAAGAGAGAATGGGTGG + Intergenic
1055006643 9:71515138-71515160 TGTTGAATCGAGTGAATGGATGG + Intergenic
1055751663 9:79513435-79513457 TGCTACATATAGTCAATGGATGG + Intergenic
1056247296 9:84708540-84708562 TGTTTAATGGGGACAATGCAAGG - Intronic
1057053135 9:91940963-91940985 TGTTAAATTCTAACAATGGATGG - Intronic
1058225596 9:102358372-102358394 TGTTAAATGGACATAATGTAGGG + Intergenic
1059887174 9:118758845-118758867 TGTTTAAGAGAGAAAATCGAGGG - Intergenic
1186099379 X:6139349-6139371 TGTTACATTGTGACATTGGAGGG - Intronic
1187073577 X:15912241-15912263 TGTTAAATAGTGATAGTAGAGGG + Intergenic
1187969639 X:24646968-24646990 TGGTAAGTAAAGACAAAGGATGG - Exonic
1188631792 X:32372474-32372496 TGTAGAATAGAGATGATGGAAGG - Intronic
1189560624 X:42188051-42188073 TGTTTAAAAGAGACCATGCATGG - Intergenic
1190568231 X:51752992-51753014 TGTTAAACAGTAACAAAGGAAGG - Intergenic
1192601869 X:72473105-72473127 TGTTCTCTAAAGACAATGGAGGG - Intronic
1193874286 X:86841228-86841250 AGTTACACAGAGACAATGGTTGG - Intergenic
1194423627 X:93708611-93708633 TGTGAAATAGAGACAATGATAGG + Intronic
1194435667 X:93866265-93866287 AGTAAAACAGAGACAATGAAAGG + Intergenic
1194620547 X:96165427-96165449 GGTTAAATACAAACAATGCATGG + Intergenic
1196183128 X:112716930-112716952 TATTAAATAGGGGCAATGTAGGG - Intergenic
1196362889 X:114887707-114887729 TTTTAATCAGAAACAATGGAGGG - Intronic
1196959826 X:120989480-120989502 TGATAAAAAGAGACAAAGCAAGG + Intergenic
1198889510 X:141377401-141377423 TGTTAGATAGAAACAAAGAAAGG + Intergenic
1198990324 X:142506650-142506672 TGGTAAATATAGACAACTGAAGG - Intergenic
1201245953 Y:12003925-12003947 AATTAAATGGTGACAATGGATGG - Intergenic
1201588098 Y:15583853-15583875 TGTCTAATAGAGACAAGGAATGG + Intergenic