ID: 903968847

View in Genome Browser
Species Human (GRCh38)
Location 1:27106217-27106239
Sequence CACTCTGGGCTGAGGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 321}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903968847_903968852 4 Left 903968847 1:27106217-27106239 CCTGGGTCCCTCAGCCCAGAGTG 0: 1
1: 0
2: 3
3: 33
4: 321
Right 903968852 1:27106244-27106266 GAACTCCTCAATCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 103
903968847_903968857 19 Left 903968847 1:27106217-27106239 CCTGGGTCCCTCAGCCCAGAGTG 0: 1
1: 0
2: 3
3: 33
4: 321
Right 903968857 1:27106259-27106281 AGAGCTGGGTGGATCCTTAAAGG 0: 1
1: 0
2: 2
3: 23
4: 243
903968847_903968854 8 Left 903968847 1:27106217-27106239 CCTGGGTCCCTCAGCCCAGAGTG 0: 1
1: 0
2: 3
3: 33
4: 321
Right 903968854 1:27106248-27106270 TCCTCAATCCAAGAGCTGGGTGG 0: 1
1: 0
2: 2
3: 13
4: 138
903968847_903968853 5 Left 903968847 1:27106217-27106239 CCTGGGTCCCTCAGCCCAGAGTG 0: 1
1: 0
2: 3
3: 33
4: 321
Right 903968853 1:27106245-27106267 AACTCCTCAATCCAAGAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903968847 Original CRISPR CACTCTGGGCTGAGGGACCC AGG (reversed) Intronic
900174928 1:1287434-1287456 CACGCTGGCCTGAGGGGCCATGG - Intronic
900330892 1:2133915-2133937 CCCTCAGGGCTGAGGGGCACAGG + Intronic
900652217 1:3735250-3735272 TGCGCTGGGCTGAGGAACCCCGG - Exonic
900655400 1:3754382-3754404 CGCTCTGTGCTCAGGGAGCCAGG + Intronic
901211449 1:7528513-7528535 GACTCAGAGCTGAGGAACCCAGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902395269 1:16129021-16129043 CCCTCATGGCTGTGGGACCCTGG + Intronic
902792352 1:18777960-18777982 AACTCAGGGCAGAGAGACCCGGG - Intergenic
903261965 1:22136379-22136401 CCTGCTGGGCTGAGGGAACCTGG + Intronic
903968847 1:27106217-27106239 CACTCTGGGCTGAGGGACCCAGG - Intronic
904133581 1:28293541-28293563 CACTGTGGGCTGGGGAAGCCAGG + Intergenic
905626578 1:39493502-39493524 GAGTCTGGGCTGAGGAACACAGG + Intronic
906061227 1:42949994-42950016 CACTCTGAGCTGAGACAGCCCGG + Intronic
906480899 1:46198329-46198351 CACTCACGGCTTAGGGGCCCCGG + Intronic
907452936 1:54558913-54558935 CACGCTGGGCTCAGCGACCCAGG + Intronic
910102583 1:83594369-83594391 CACTGTGGGCTAAAGAACCCTGG - Intergenic
913392885 1:118333927-118333949 CCCTCTGGGATGAAGGACTCTGG + Intergenic
913652274 1:120928803-120928825 CTCTCTGTGCTGTGGGACACTGG - Intergenic
914168836 1:145200268-145200290 CTCTCTGTGCTGTGGGACACTGG + Intergenic
914523957 1:148444227-148444249 CTCTCTGTGCTGTGGGACACTGG + Intergenic
914599719 1:149191642-149191664 CTCTCTGTGCTGTGGGACACTGG - Intergenic
914642448 1:149622913-149622935 CTCTCTGTGCTGTGGGACACTGG - Intergenic
914922951 1:151859899-151859921 CACTCTGCCCAGAGGAACCCTGG + Intergenic
915020876 1:152777455-152777477 TCCTCTGAGCTCAGGGACCCCGG - Intronic
920423104 1:205849436-205849458 CACTCTTTGCTGTGGGGCCCTGG + Intronic
922469434 1:225866829-225866851 CACTGTGGGCTGAGGGGTGCTGG - Intronic
922604755 1:226882747-226882769 CACTCAGGGCTTAGGGACGATGG - Intronic
922718545 1:227888962-227888984 CTCTCTGGGCTGTGGGCACCAGG - Intergenic
922764950 1:228151837-228151859 CACTCGGGGCTGACCGTCCCAGG + Intronic
922970414 1:229731645-229731667 CATTCTGGGGTTTGGGACCCTGG - Intergenic
924655122 1:245967676-245967698 CCCTCTGGTCTGAGGGCTCCAGG - Intronic
1062958208 10:1554045-1554067 TGCCCTGGGCTGTGGGACCCAGG - Intronic
1064154755 10:12894660-12894682 CACACTGAGCTCAGGGACCCAGG + Intergenic
1064164714 10:12976081-12976103 CACTCTGGGATGAGTGAGCAAGG - Intronic
1067225401 10:44372970-44372992 GAGACTGGGCTGAGGGAGCCTGG - Intronic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1069532531 10:69229805-69229827 GACTCTGGGCCCAGGGACCTCGG - Intronic
1069635507 10:69922619-69922641 CACTATGGGGTGTGGGCCCCAGG - Intronic
1070916589 10:80158964-80158986 CACTCTGGGCTGAGCGATCTTGG + Intronic
1072890071 10:99316030-99316052 AACAGTGGGCTGAGGGACCCAGG - Intergenic
1073561320 10:104499200-104499222 TACTCTGGGCTGAGTTACCCAGG - Intergenic
1074965304 10:118486139-118486161 CACTCTAGGCTGGGTGACCTCGG - Intergenic
1075247682 10:120838436-120838458 CACTCATGGCTGAGGGAGCAGGG + Intergenic
1075438187 10:122460487-122460509 CACCCTGGGCAGAGGCACCCAGG - Intergenic
1075875986 10:125806024-125806046 CACTGTGGTCTGAGGATCCCTGG - Intronic
1076149852 10:128153234-128153256 GTCCCTGGGCTGAGAGACCCTGG - Intergenic
1077093960 11:791596-791618 GTCTCTGGGCTGGGGGCCCCCGG - Exonic
1077268804 11:1665648-1665670 CCCTCTGGGCTCAGGGAGCTGGG - Intergenic
1077271949 11:1685532-1685554 CCCTCTGGGCTCAGGGAGCTGGG + Intergenic
1077338077 11:2014274-2014296 CACTCTGGCCTGAGGGCCCGTGG + Intergenic
1077539468 11:3139731-3139753 CTCTCTGGGCTCCTGGACCCTGG + Intronic
1078097802 11:8311308-8311330 CACTCCAGCCTGAGGCACCCAGG - Intergenic
1078196163 11:9138645-9138667 CACTGCGGGCAGAAGGACCCAGG + Intergenic
1079241699 11:18726461-18726483 CTCTCTGAGCTGAGGGGCTCAGG + Intergenic
1081587647 11:44398340-44398362 CACTCTGGGTTGTGAGCCCCCGG - Intergenic
1081814216 11:45929589-45929611 CACCCTGGGCTGAGGACCCACGG + Intronic
1083265544 11:61545208-61545230 CACTCTTGGCTGATGGACGTAGG - Intronic
1084267679 11:68013196-68013218 CACTCTGGACTGAGGCCCCCAGG - Intronic
1084421480 11:69062751-69062773 CACTTTGGGCTCAGTGACTCTGG + Intronic
1084462242 11:69302519-69302541 CACTAAGAGCTTAGGGACCCAGG + Intronic
1084710772 11:70842628-70842650 CACTCCTGGCCGAGGGACCTAGG - Intronic
1085310943 11:75516277-75516299 CACTCAGGGCTGAAGGAGCAAGG - Intronic
1085413054 11:76302884-76302906 CACTCTGGGCTCAGTGACCCTGG - Intergenic
1086871010 11:92036573-92036595 CACTCTGGGCTGAAGGACAATGG - Intergenic
1089961184 11:122618520-122618542 CCATTTGGGCTGTGGGACCCAGG + Intergenic
1090189456 11:124758960-124758982 AACTCGGGAGTGAGGGACCCTGG - Intronic
1090351536 11:126111401-126111423 CCCTCTGGGCTGCTGGCCCCGGG + Intergenic
1202821061 11_KI270721v1_random:69456-69478 CACTCTGGCCTGAGGGCCCGTGG + Intergenic
1092150785 12:6246948-6246970 CACCCAGGGATAAGGGACCCCGG + Intergenic
1093289278 12:17301474-17301496 CTTTCTGGGCTGAAGTACCCTGG - Intergenic
1094845722 12:34360597-34360619 GGCGCTGGGCTTAGGGACCCTGG - Intergenic
1095163234 12:38941211-38941233 CACTATGGGCTAAAGGACTCTGG + Intergenic
1098387549 12:69934921-69934943 CACTCTGGGCTGTGGGTTTCAGG + Intronic
1103057830 12:117835601-117835623 CACTCTGGGCTGAGAGCCACTGG - Intronic
1103302248 12:119937049-119937071 CCCTCTAGGCTGAGGGAACAGGG - Intergenic
1103937160 12:124482809-124482831 CACCCAGGCCTGAGGGACCACGG - Intronic
1104029479 12:125054024-125054046 CACTTTGGCCTGATGGACTCAGG + Intergenic
1104230667 12:126880958-126880980 CACCCTGGGCTGGGGGTCCGGGG - Intergenic
1104629730 12:130390497-130390519 AAACCTGGGCTGAGGGACCCCGG - Intergenic
1105022905 12:132828980-132829002 CCCTGTGGGCAGAGGGTCCCCGG - Intronic
1106402362 13:29442716-29442738 AACTGTGTGCTGAGGCACCCTGG - Intronic
1107490523 13:40876766-40876788 CTTTCTGGGCTGAGGTACCTTGG + Intergenic
1107604056 13:42040910-42040932 CACGCTGGGCTGCGGGCGCCGGG - Intronic
1112441167 13:99426101-99426123 GACTCTGAGCTGAGTGACCAGGG - Intergenic
1114296042 14:21330082-21330104 CACTCTGGCCTGAGTGACAGAGG + Intronic
1114626208 14:24131837-24131859 CACTCAAGGCTGTGGGAGCCGGG + Intronic
1116770714 14:49123955-49123977 CACTCCAGGCTGAGGGACAAGGG + Intergenic
1117782958 14:59253819-59253841 TACTCTGGGCTGAGGGCTCATGG - Intronic
1121127708 14:91418279-91418301 CGCTCTGGGCTTGGGGACCTCGG + Intergenic
1122122086 14:99560144-99560166 CACTCTGGGCTGAAAGGTCCTGG - Intronic
1122659731 14:103287339-103287361 CACTCTGTGCTGTGTGGCCCTGG + Intergenic
1122721486 14:103724906-103724928 CATTGGGGGCTGCGGGACCCAGG - Intronic
1122856626 14:104563254-104563276 TGCGCTGGGCTGAGGGACCAGGG - Intronic
1123493360 15:20799912-20799934 CACTCTGGCATGGGGGAACCCGG + Intergenic
1123549869 15:21369014-21369036 CACTCTGGCATGGGGGAACCCGG + Intergenic
1124182639 15:27491176-27491198 CACTGAGGGCTGAGGGAGCTGGG - Intronic
1124188883 15:27554223-27554245 CACTGTGGTCTCAGGGCCCCTGG - Intergenic
1125187265 15:36945274-36945296 CTATCTGGGCTGATGGATCCAGG + Intronic
1125550454 15:40540854-40540876 CTCTCTGGACTGAGGGCACCAGG - Intronic
1125721071 15:41845458-41845480 CCCAAAGGGCTGAGGGACCCTGG - Intronic
1127077238 15:55338712-55338734 CACTCTTGGCTGACTTACCCTGG + Intronic
1127803195 15:62495063-62495085 AACTCTAGGCTCAGGGGCCCAGG - Intronic
1129188028 15:73922496-73922518 GGCTCTGGGCTCAGGGCCCCCGG + Intergenic
1129523870 15:76201991-76202013 CACTGGGTGCTGGGGGACCCAGG - Intronic
1129718430 15:77864976-77864998 CACTCCAGGCTGAGTGGCCCCGG - Intergenic
1129740331 15:77986786-77986808 ACCTCAGGGCTGAGGGACTCAGG - Intronic
1129845421 15:78765811-78765833 ACCTCAGGGCTGAGGGACTCAGG + Exonic
1130229012 15:82082346-82082368 CCCTCTGGGCTCAGTGACTCGGG + Intergenic
1130256427 15:82328048-82328070 ACCTCAGGGCTGAGGGACTCAGG - Intergenic
1130598525 15:85261940-85261962 ACCTCAGGGCTGAGGGACTCAGG + Intergenic
1130776678 15:86991594-86991616 GACTCTTGACTGAGGGACCATGG + Intronic
1132055352 15:98647786-98647808 CACTCTGGGCCGAGCCACACGGG + Intergenic
1202958198 15_KI270727v1_random:96232-96254 CACTCTGGCATGGGGGAACCCGG + Intergenic
1132616160 16:842075-842097 CACCCTGGGCTGGGGAACTCTGG + Intergenic
1132758942 16:1499709-1499731 CACTCTGGGCTCAGGGGACCTGG - Intronic
1132873199 16:2124618-2124640 CACTCAGAGCTGAGTGCCCCAGG + Intronic
1133020131 16:2963537-2963559 GAGTCTGGGCTGGGGGTCCCAGG + Intergenic
1133022364 16:2972413-2972435 GTCTCTGGGCAGAGGGAGCCAGG - Exonic
1133227304 16:4347759-4347781 CACTTGGGCCTGAGGGTCCCAGG + Intronic
1134121636 16:11588022-11588044 GACACTTTGCTGAGGGACCCGGG - Intronic
1134164166 16:11916358-11916380 CACTCTGGCCTGCTGGACACAGG + Intergenic
1134552287 16:15143797-15143819 CACTCAGAGCTGAGTGCCCCAGG + Intergenic
1135401768 16:22170990-22171012 CCCTCTGAGCTGTGGGTCCCGGG - Intronic
1136374395 16:29856787-29856809 CAGTCAGGGATGTGGGACCCAGG + Intergenic
1140489269 16:75320585-75320607 CAGTCTGGGGTGAGGAGCCCTGG - Intronic
1140506289 16:75475398-75475420 CACTCTGTGCTGTGTGACCATGG - Exonic
1141148461 16:81548165-81548187 CACTCTAGCCTGAGGGACAGAGG - Intronic
1141150592 16:81562228-81562250 CAATGGGGGCTGAGGGTCCCAGG - Intronic
1141664487 16:85458819-85458841 CACTTTGGGTTCAGGGAGCCTGG + Intergenic
1141755733 16:85989469-85989491 ACCTCAGGGCTGAGGGACCCTGG - Intergenic
1142110789 16:88329961-88329983 CACTCTGGGCACAGGGTGCCTGG + Intergenic
1142265989 16:89064145-89064167 GCCTCTGGGCTGCGGGAGCCGGG + Intergenic
1142315865 16:89344614-89344636 CACTCCAGGCTGAGGGGCCCAGG + Intronic
1142361823 16:89631001-89631023 CACTCTGAGCTTCGGGACCAGGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142978084 17:3656967-3656989 AAGTCTGGGGTGAGGGACTCAGG + Intronic
1143175585 17:4953151-4953173 CTGTCTGGGCTGAGGGAGCAGGG - Intronic
1144453251 17:15398586-15398608 GTCTCTGGGCTGAGCGACACCGG - Intergenic
1144698633 17:17322487-17322509 CACCCTGTGCCCAGGGACCCGGG + Intronic
1144866153 17:18337294-18337316 CACCCAGTGCTGAGGGACTCCGG - Intronic
1145004519 17:19329892-19329914 CACTCTGAGCTGAGGAGGCCGGG - Intronic
1145911489 17:28546040-28546062 CCCTCTGGGCTGAGGAGCTCTGG - Intronic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1146219745 17:31008338-31008360 CCCTTTTGTCTGAGGGACCCGGG - Intergenic
1146723899 17:35142186-35142208 CTCTCAGGCCTCAGGGACCCGGG + Intronic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1148133642 17:45277644-45277666 CAAACTGAGCTGAGGCACCCCGG + Intronic
1148904718 17:50904941-50904963 CACTCTGGGTTGGGGGAGCTGGG - Intergenic
1149343182 17:55707652-55707674 GACTCTGAGCTGAGTGACCCTGG - Intergenic
1150373630 17:64662297-64662319 CCCTCTTGTCTGAGGGACCCGGG + Intergenic
1150569804 17:66375867-66375889 CACAGTTGTCTGAGGGACCCAGG - Intronic
1150649487 17:67000640-67000662 CACTCAGGGCCTAGGGACCTTGG - Intronic
1150815254 17:68387679-68387701 CAGTCTGGGCGGAGGGTGCCGGG - Intronic
1151651783 17:75474846-75474868 CACTGTGGGCTGGAGGACCGGGG - Intronic
1152451821 17:80386470-80386492 CCCACTGGGCTTAGGGACTCTGG - Intronic
1152574041 17:81132462-81132484 CACTCAGGGATGGGGGACGCAGG + Intronic
1152710783 17:81869716-81869738 GAGTCTGGGCTGCGGGAGCCGGG - Intronic
1153799379 18:8656053-8656075 TCCTCTGGGCTGGGGGAACCAGG + Intergenic
1154450913 18:14474450-14474472 CACTCTGGCATGGGGGAACCCGG + Intergenic
1156486988 18:37472650-37472672 CACTCTGAGCTGTGTGACCTTGG - Intronic
1157481338 18:48055886-48055908 CACCCTGGACTGAGGAAACCTGG + Intronic
1158846252 18:61445929-61445951 CAGCCTAGGCTGAGGGTCCCAGG + Intronic
1159139737 18:64378930-64378952 GACTCTGGGCTGAGGGACCAAGG + Intergenic
1159879053 18:73840693-73840715 CAATCTGGTGTGAGGGACACAGG - Intergenic
1160156786 18:76441032-76441054 GACCCTGGGCACAGGGACCCTGG + Intronic
1160591449 18:79947139-79947161 CACACTGGGCTGCAGGGCCCTGG - Intronic
1160874690 19:1291526-1291548 CACGCTGGGCTTCAGGACCCGGG + Intronic
1161013864 19:1973565-1973587 CAGCCAGGGCTGAGGGACCTGGG - Intronic
1161300950 19:3543065-3543087 CACTCTGGGGTGAGGGGTACAGG + Intronic
1161337914 19:3724162-3724184 CACTCTGGGTTCGGGGGCCCTGG + Intronic
1161443183 19:4304101-4304123 CACCGTCTGCTGAGGGACCCTGG + Intergenic
1161614260 19:5261170-5261192 CCCTCTGGGCTGAGGGAGGGAGG + Intronic
1162188750 19:8927931-8927953 CACTCTGGGCTGAGAGATGGAGG - Intronic
1162638299 19:11987543-11987565 CACTCAGGGCTGAGGGGGCGGGG + Intergenic
1162664104 19:12195237-12195259 GACTCTGGGGTCTGGGACCCGGG + Intergenic
1162698486 19:12495773-12495795 CACACAGGGCTCCGGGACCCGGG - Intronic
1162839945 19:13349126-13349148 CACTCTTGGCTAGGGGACCTTGG + Intronic
1163502121 19:17682459-17682481 CACTCAGGCCTGCTGGACCCAGG + Intronic
1163519353 19:17782808-17782830 CACCCTGGGCTGAAGGAGGCAGG - Intronic
1163698755 19:18776831-18776853 CCCTCATGGCTGAGGGAGCCGGG + Intronic
1163760343 19:19133032-19133054 GGCTCTGGGCTCAGGGACACAGG - Intronic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1165464312 19:35963761-35963783 CACACTGTGCTGCGGGACCTGGG + Intergenic
1165694549 19:37891090-37891112 CACTCTCGGGTGAGGGACTAAGG - Intronic
1166727991 19:45040328-45040350 TTGTCTGGGGTGAGGGACCCTGG + Intronic
1167532603 19:50027476-50027498 CACTCTGGGCTGGATGACCTTGG + Intronic
1167643296 19:50693602-50693624 GGCTCTGGGCTGGCGGACCCTGG - Intronic
1167713178 19:51124739-51124761 CGCTCTGGCCTCAGGGACCCAGG + Intergenic
1167715777 19:51142134-51142156 CGCTCTGGCCTCAGGGACCCAGG + Intergenic
1168327375 19:55545189-55545211 CACTCGGGGCTGGGGGCTCCTGG - Intronic
925310663 2:2879258-2879280 CATTCTGGGGTGGGGGTCCCTGG - Intergenic
925957938 2:8986527-8986549 CACTCTAGGCTGGGGGAGACAGG + Intronic
927570375 2:24153824-24153846 CATTGTGGGCTGAAGTACCCTGG - Intronic
928456340 2:31426279-31426301 TATCCTGGGCTCAGGGACCCGGG - Intergenic
929054555 2:37864593-37864615 GTCTCTGTGCTGAGGCACCCAGG + Intergenic
929438539 2:41947773-41947795 CAGTCTGGGGTGAGGGCCACGGG - Intronic
929579032 2:43070175-43070197 CTCTTTGGGCTGAGGCTCCCAGG - Intergenic
931665141 2:64605090-64605112 CACCCTGGGTTGAGTGATCCAGG - Intergenic
931698402 2:64889357-64889379 CCTTCTGGGCTGAAGTACCCTGG + Intergenic
932303791 2:70687188-70687210 CACTCTGGGCTGTGTGCCCTTGG - Intronic
932314653 2:70771866-70771888 CTCTCAGGGATGAGGGAGCCAGG - Intergenic
932750403 2:74367938-74367960 CACCCTGGGGTGAGGGAGTCAGG + Intronic
933089552 2:78104035-78104057 CACTCTGGCCTGAGGCACCTGGG - Intergenic
933969466 2:87458508-87458530 CCCACAGGGCAGAGGGACCCGGG - Intergenic
934123242 2:88860898-88860920 CACTTTCGGCGGAGGGACCAAGG - Intergenic
934559704 2:95306784-95306806 CACTGTGGGGTGAGGGGCCAGGG + Intronic
935090619 2:99891744-99891766 AACTATGAGCTGTGGGACCCTGG - Intronic
936324320 2:111491986-111492008 CCCACAGGGCAGAGGGACCCGGG + Intergenic
937030092 2:118731777-118731799 CAATCTGAGCTGGGGAACCCTGG - Intergenic
937324730 2:120983648-120983670 CTATCTGGGCTGAGAGAACCAGG + Intronic
937911624 2:127078333-127078355 CACTTAAGGCTGTGGGACCCTGG + Intronic
938182013 2:129192175-129192197 CACTGTGGGCTGTGGGGCACTGG - Intergenic
938297021 2:130184773-130184795 CACTCAGGGCTCTGGGAGCCAGG + Intronic
938512207 2:131961851-131961873 TACTCTGGGATGAGAGACCAAGG + Intergenic
940834584 2:158506806-158506828 CACTCTAGTCTGAGGGAATCGGG - Intronic
941958473 2:171229336-171229358 GACTCTGGGCTGAGGAAGACAGG - Intronic
944882087 2:204023631-204023653 CTCTGTGGGCTAAGAGACCCTGG - Intergenic
948752322 2:240139807-240139829 CACACTGGGCAGGGGGAGCCAGG - Intronic
948939728 2:241189766-241189788 CATTCAGGGCTGGGGGACACGGG + Intronic
1168850631 20:974358-974380 CTCTCTGGGCTGATGGACAATGG + Intronic
1169201501 20:3712437-3712459 CCCTCTGGGCCCAGGGACCAGGG + Intergenic
1169374151 20:5052946-5052968 CACTCTGGCCTGGGGGACTGAGG - Intergenic
1172876674 20:38168522-38168544 CACTCTTGGCTGTGTGACTCTGG + Intergenic
1172884567 20:38222536-38222558 GAGGCTGTGCTGAGGGACCCCGG - Exonic
1173607731 20:44343518-44343540 CCGTCAGGGCTGAGGGCCCCTGG + Intronic
1173689666 20:44950697-44950719 CACTCTGGTTTGTGGGAGCCTGG - Intronic
1176097697 20:63351918-63351940 CATTCAGGGCTGAGGCAGCCAGG + Intronic
1176376133 21:6087668-6087690 CCCTCAGGGCTGAGGAGCCCCGG + Intergenic
1176445322 21:6816123-6816145 CACTCTGGCATGGGGGAACCCGG - Intergenic
1176823490 21:13681156-13681178 CACTCTGGCATGGGGGAACCCGG - Intergenic
1179747342 21:43450576-43450598 CCCTCAGGGCTGAGGAGCCCCGG - Intergenic
1179921908 21:44512106-44512128 CACACAGGACTGAGGGAGCCAGG + Intronic
1181102829 22:20552872-20552894 CACTCTGGGGTTGGGGACCCTGG - Intronic
1181119620 22:20657302-20657324 CACTCTGGCCTAAGGCACCACGG + Intergenic
1181864442 22:25844285-25844307 CACTCTGGGCTGAGCAGCCAGGG - Intronic
1183081992 22:35462680-35462702 CACTCCTGGCTGGGGGACCCTGG - Intergenic
1183655822 22:39184192-39184214 CACCCTGGGCTGGGAGACACTGG + Intergenic
1183872253 22:40748760-40748782 CACTCTGGCCTGAGGTTCCTGGG - Intergenic
1184247036 22:43240984-43241006 AACTCAGGGCTGAGGGCACCGGG + Intronic
1184276062 22:43410501-43410523 ATCTCTGGCCTGAGGGCCCCAGG + Intergenic
1184373783 22:44099031-44099053 CTGTCTGGGCTCTGGGACCCTGG + Intronic
1184409061 22:44316189-44316211 CACCCTGGGGAGAGGGACCTGGG + Intergenic
1184599274 22:45532952-45532974 CCCTCTGGGCAGACGAACCCAGG - Intronic
949158099 3:851013-851035 CCTTCTGGGCTGAAGTACCCTGG - Intergenic
949624216 3:5849360-5849382 CAATCTTGGATGAGGGAGCCTGG + Intergenic
950436907 3:12985612-12985634 CACTCTGGCCTGGGGAACCCAGG - Intronic
950638740 3:14334183-14334205 CACTCTGGGCAGAGGGGGCTGGG - Intergenic
951494927 3:23315985-23316007 CTCTCTGTGCTGAGCTACCCTGG + Intronic
953877060 3:46672328-46672350 CCCTGAGGGCTGAGTGACCCAGG + Intronic
953913958 3:46906304-46906326 CAGCCTGGGCTGAGGGAGACAGG - Intergenic
954809609 3:53240010-53240032 CAGTCACTGCTGAGGGACCCAGG + Intronic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
956114491 3:65904590-65904612 CATTCTGGGCTGAGGGATGGTGG - Intronic
957497218 3:81007740-81007762 CACTCTGGAGTGATGGATCCAGG + Intergenic
961187013 3:124924294-124924316 CACTGTGGGCTGAGACTCCCAGG + Intronic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
962118450 3:132536445-132536467 AACTGTGTGCTGAGGCACCCTGG - Intronic
962404790 3:135091616-135091638 AACTCTGGGGTGAGGAAGCCTGG + Intronic
966912013 3:184564998-184565020 CAGCCAGGGCTCAGGGACCCTGG - Intronic
968511001 4:995929-995951 CACTCTGGGGTACGAGACCCTGG - Intronic
968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG + Intergenic
969123126 4:4924289-4924311 CACTGTGGGGTGAGGAACCTGGG + Intergenic
969455586 4:7298043-7298065 CACTCTGGGAGGACGGACCTGGG - Intronic
976603370 4:86959782-86959804 CATTCTGGGCTGAAAGAACCAGG + Intronic
977055147 4:92182444-92182466 CTCCCTGGCCTGATGGACCCAGG - Intergenic
977341475 4:95763939-95763961 CACTATGGGCTAAGGTGCCCTGG + Intergenic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
984843727 4:184092415-184092437 CACTCTGGGCAGAGGCACAGTGG - Intronic
985877007 5:2607556-2607578 CACTCTGGGCTTGGGAAGCCGGG - Intergenic
989984537 5:50682577-50682599 CTCTCTGTGCTGTGGGACACTGG - Intronic
991550539 5:67831210-67831232 CACCCTGGTGTGAGGGCCCCTGG - Intergenic
992762511 5:79963040-79963062 CACTCTGTGCTGTGGCTCCCGGG - Intergenic
994286133 5:97970604-97970626 CACTCTTGACAGAGGGACCTAGG - Intergenic
997512056 5:134460760-134460782 CACTCTGGGCAGAAGGGGCCTGG - Intergenic
997887332 5:137641903-137641925 CCCTCTGAGCTGAGGCACCCAGG - Intronic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
999277606 5:150341818-150341840 CACTGTGGTGTGAGGGAACCAGG + Intergenic
999329545 5:150663067-150663089 CACTCTGGCCTGCTGGCCCCAGG + Intronic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1000965536 5:167651673-167651695 CACTCTGCCCTGTGGGACTCAGG + Intronic
1001671824 5:173480129-173480151 CACTTTGGGCTGATGAACCAAGG + Intergenic
1002304227 5:178273919-178273941 CCCTCTGGGCCGGAGGACCCTGG + Intronic
1002443449 5:179275932-179275954 CCCTCTGGGCTCAGGCATCCTGG + Intronic
1002518002 5:179773778-179773800 CACACTGGGAAGAGGGCCCCGGG - Intronic
1002590593 5:180289495-180289517 TACTCAGAGCTGAGGGACCCAGG + Intronic
1002603158 5:180366447-180366469 CACTCTGGGCTCCGGGCCCTGGG - Intergenic
1003114786 6:3276603-3276625 CAGACAGAGCTGAGGGACCCCGG - Intronic
1003124197 6:3342546-3342568 GAATCTGGGCTCAGGGCCCCGGG - Intronic
1006904723 6:37525625-37525647 CACCCTGGGCTGGGGGACTTGGG - Intergenic
1007362879 6:41371458-41371480 CACCCTGGGCTCTGGGACGCTGG + Intergenic
1007485832 6:42179847-42179869 CATTCTGCCCTGGGGGACCCTGG + Exonic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1008238468 6:49077959-49077981 CTCACTGGGCTGATTGACCCAGG + Intergenic
1012611711 6:101227275-101227297 CCTTCTGGGCTGAAGTACCCTGG + Intergenic
1013242157 6:108256195-108256217 CACTCTAGGCTGAGAGACAGAGG + Intronic
1014228650 6:118877123-118877145 CACCCTGGGCTGTGGGTCCTTGG - Intronic
1015414373 6:132932050-132932072 CAAGCTGGGCTGAGCCACCCGGG - Intergenic
1016357209 6:143231509-143231531 CTCTCTTGGCTGAGGGAGCATGG + Intronic
1017001378 6:149999884-149999906 AACTCAGGGCTGAGCTACCCAGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019028035 6:168988259-168988281 CACTCTGGGCTGATGGCGTCTGG + Intergenic
1019645192 7:2125152-2125174 CACTGTGGGCTGCATGACCCGGG - Intronic
1020086213 7:5312283-5312305 CACTCTGCTCTGAAGGACTCGGG + Intronic
1020187489 7:5970253-5970275 CACCTTGGGCTAGGGGACCCAGG - Intronic
1020295427 7:6754517-6754539 CACCTTGGGCTAGGGGACCCAGG + Intronic
1022895680 7:34748496-34748518 TACTCTGGGCTGTGTGACCTTGG + Intronic
1023129417 7:36987557-36987579 CATTACGGGCTGAGGGTCCCAGG - Intronic
1023813443 7:43930019-43930041 CACTCTGGGCTGAATGGCTCTGG + Intronic
1024394014 7:48845772-48845794 CACTCTGGGCTGGGTGGGCCAGG - Intergenic
1024401227 7:48926641-48926663 CACTCTGGGCTGGGTGGGCCAGG + Intergenic
1024944067 7:54791294-54791316 GACTCTGGCCTGAGGAGCCCAGG - Intergenic
1026014959 7:66665566-66665588 ACCTCTGAGCTGAGTGACCCTGG + Intronic
1026866550 7:73827802-73827824 CACGCAGGGCTAGGGGACCCAGG - Exonic
1026867776 7:73833923-73833945 CACTCTGGAAGGAGGGATCCAGG + Intergenic
1028929637 7:96398254-96398276 CACTGTGGGCTGAAGTACTCTGG - Intergenic
1032240189 7:130153928-130153950 CACTATGGGCTGAGGGTCCCTGG + Intergenic
1032522301 7:132554627-132554649 CCCTCTGCCCTGAGGCACCCTGG - Intronic
1035690960 8:1559325-1559347 CACCCTGGGCTGAGGGCTGCAGG + Intronic
1036587300 8:10136169-10136191 CACGCTGGGCACAGGGACCCCGG + Intronic
1037649864 8:20826467-20826489 CACTGTGGGCTGAGGAAATCAGG + Intergenic
1037734171 8:21553905-21553927 GCCTCTGGATTGAGGGACCCAGG + Intergenic
1037946763 8:22994457-22994479 CTATCTGGGCTGAGCGACCTTGG + Intronic
1038306367 8:26406778-26406800 CACTCTGGCCTGGGTGACACAGG + Intronic
1038535879 8:28352485-28352507 CACTGTGGGCTGTGGGTCACAGG + Intronic
1038847279 8:31242071-31242093 TATTCTGGGCTGAGGAACCCAGG - Intergenic
1039434236 8:37548590-37548612 CTCTCTGGGCTCAGGCAGCCAGG + Intergenic
1039924318 8:41915598-41915620 CTGTTTGGGCTGAGTGACCCGGG - Intergenic
1040419186 8:47223129-47223151 CAGTCTGGCCTGATGGACACAGG - Intergenic
1040552273 8:48446658-48446680 CACCCTGTGCTGTGGGACCCTGG + Intergenic
1040558938 8:48506513-48506535 CGCCCTGAGCTGAGGGCCCCGGG + Intergenic
1041030919 8:53734439-53734461 CCTTCTGGGCTGAAGTACCCTGG - Intronic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1042966457 8:74358725-74358747 CACTATGGTCTGAGGATCCCTGG - Intronic
1048981576 8:139705503-139705525 CTCCCTGGCCTCAGGGACCCCGG + Intergenic
1049102152 8:140587644-140587666 CACCCTGGGCTGTGAGCCCCTGG + Intronic
1049530026 8:143149426-143149448 CACTGTGGGCTGGGGGATTCAGG - Intergenic
1049796617 8:144499996-144500018 AGCCCTGGGCTGAGGGGCCCTGG + Intronic
1053177471 9:35938521-35938543 GCATCTGGGCTGGGGGACCCTGG - Intergenic
1055353282 9:75411734-75411756 CACTCTAGCCTGAGGGACAGAGG + Intergenic
1057211767 9:93204451-93204473 CCCTCGGGGCTGTGGGCCCCAGG + Intronic
1058083062 9:100719289-100719311 CACCATGGGCTGAGGAAACCAGG + Intergenic
1059402494 9:114078968-114078990 CACTCCCGGCTGAGGGATTCTGG - Intergenic
1060154364 9:121308970-121308992 CACAGTGGGCTGAGGGGCCCTGG + Intronic
1060730638 9:126034693-126034715 CTCTCTAGGCTGAGGGACATGGG + Intergenic
1060791638 9:126489294-126489316 CACTTTGGGGTGAGGGGGCCTGG - Intronic
1061033818 9:128102516-128102538 GACTCTGGGCTAAGGGTCCCTGG - Intronic
1061119502 9:128634490-128634512 AACTCCAGGCTGAGGGACCCGGG - Intronic
1062003743 9:134229239-134229261 CACTGTGGGCTGAGGGACGGAGG + Intergenic
1062190038 9:135243280-135243302 CACTCTGGGCTGAGTGTTCGTGG + Intergenic
1062228201 9:135465749-135465771 CTCTGAGGGCTGAGGGAGCCGGG - Intergenic
1203523873 Un_GL000213v1:68402-68424 CACTCTGGCATGGGGGAACCCGG + Intergenic
1186466030 X:9785679-9785701 CACTCTGGACTTAGAGAGCCGGG - Intronic
1189280223 X:39816002-39816024 CTCCCTGGACTGAGGGAGCCAGG + Intergenic
1198100177 X:133415781-133415803 TACTCCGGGCTGAAGGGCCCAGG + Intergenic
1198460608 X:136859400-136859422 CACTCTGCCCTGAGGGACAGAGG + Intronic
1200072948 X:153537987-153538009 CACTGTGGCCTTGGGGACCCAGG - Intronic
1200161896 X:154013869-154013891 CCCTCTGAACTGAGGGGCCCCGG - Intronic
1201313698 Y:12621740-12621762 CACTGGGGGCGGAGGGACCAAGG - Intergenic