ID: 903970010

View in Genome Browser
Species Human (GRCh38)
Location 1:27112585-27112607
Sequence CTATCAAAGGTGAGGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903970003_903970010 14 Left 903970003 1:27112548-27112570 CCCTGGAGGAAAGCACTAATCCT 0: 1
1: 0
2: 2
3: 14
4: 180
Right 903970010 1:27112585-27112607 CTATCAAAGGTGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 174
903970004_903970010 13 Left 903970004 1:27112549-27112571 CCTGGAGGAAAGCACTAATCCTC 0: 1
1: 0
2: 1
3: 4
4: 137
Right 903970010 1:27112585-27112607 CTATCAAAGGTGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 174
903970002_903970010 25 Left 903970002 1:27112537-27112559 CCACGTGCAGACCCTGGAGGAAA 0: 1
1: 0
2: 0
3: 22
4: 194
Right 903970010 1:27112585-27112607 CTATCAAAGGTGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 174
903970005_903970010 -6 Left 903970005 1:27112568-27112590 CCTCTGCCACTTTGCAGCTATCA 0: 1
1: 1
2: 3
3: 20
4: 202
Right 903970010 1:27112585-27112607 CTATCAAAGGTGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903970010 Original CRISPR CTATCAAAGGTGAGGCTGGC TGG Intronic
900604313 1:3517008-3517030 CCATCTCAGGTGAGGCAGGCCGG - Intronic
900870800 1:5301370-5301392 GTATCAAAGGTGAGGCCTGGTGG - Intergenic
901399874 1:9008364-9008386 CAAGCAAAAGCGAGGCTGGCTGG + Intronic
901841692 1:11957789-11957811 CTATGGCAGGTGGGGCTGGCTGG + Intronic
902336759 1:15758686-15758708 CCATAAAAGGTGAGGCTCGGGGG - Intronic
903970010 1:27112585-27112607 CTATCAAAGGTGAGGCTGGCTGG + Intronic
906110623 1:43319682-43319704 CTAGCCAAGGTGGGGCTTGCTGG + Intronic
907203458 1:52748564-52748586 TTTTGAAAGATGAGGCTGGCTGG + Intronic
907705855 1:56831799-56831821 CTATCAAATGTCAGGGGGGCTGG - Intergenic
908163955 1:61439094-61439116 CTATCTAGAGTAAGGCTGGCTGG + Intronic
917166459 1:172118104-172118126 CAATCAAAGGTGAGGAAGGAAGG + Intronic
917227297 1:172799026-172799048 TTATGAGAGGTGAAGCTGGCTGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
924349500 1:243101322-243101344 CAATAAAACATGAGGCTGGCTGG - Intergenic
1065433112 10:25679953-25679975 TGATCAAATGAGAGGCTGGCAGG + Intergenic
1065809874 10:29431478-29431500 CTTTCAGAGGTCAGGGTGGCAGG - Intergenic
1067495372 10:46756574-46756596 ACAGCAAAGGTGCGGCTGGCTGG - Intergenic
1067599281 10:47583814-47583836 ACAGCAAAGGTGCGGCTGGCTGG + Intergenic
1069071999 10:63998718-63998740 CTGGCAGGGGTGAGGCTGGCTGG - Intergenic
1069716240 10:70523201-70523223 CCATGAGAGGTGAGGGTGGCTGG + Intronic
1069874095 10:71551207-71551229 CTAACAGAGGTAAGGCTGCCAGG + Intronic
1070833362 10:79433545-79433567 TTAGCGAAGGTGGGGCTGGCAGG + Intronic
1071220768 10:83462562-83462584 CTCTGAGAGGTGAGGCTGGCTGG + Intergenic
1071347764 10:84708930-84708952 CTATTAAAGCTGTTGCTGGCTGG + Intergenic
1071519675 10:86321658-86321680 AAATCAAATGTGAGGGTGGCTGG + Intronic
1075785866 10:125049700-125049722 CTATCAAAGCAAACGCTGGCTGG + Intronic
1075874452 10:125794950-125794972 CTAAAAAATGTGATGCTGGCTGG + Exonic
1076880262 10:133236416-133236438 CCCTCAAGGGGGAGGCTGGCGGG - Intergenic
1080153002 11:29076075-29076097 CTACCAAAGGTGATGCTCTCTGG - Intergenic
1080833276 11:35916397-35916419 CTATGAAATGTGACCCTGGCTGG - Intergenic
1083181031 11:60985479-60985501 TTATAAAAGGAGAGGGTGGCCGG - Intronic
1085179829 11:74524457-74524479 TTTTCACAGGTGAAGCTGGCAGG - Intronic
1088814276 11:113410655-113410677 TTCGCAAGGGTGAGGCTGGCCGG + Exonic
1089125166 11:116171714-116171736 CTATCACAGGTCAGGGTGCCTGG + Intergenic
1090540434 11:127697224-127697246 TTATGAAAAGTGAGGCTGTCAGG - Intergenic
1092439925 12:8491619-8491641 CTATAAAAGGGGAAGCTGGTTGG - Intergenic
1094694255 12:32801495-32801517 CTGTCAAATGTGCTGCTGGCTGG + Intronic
1096130855 12:49157853-49157875 CTATAAAAGATGAGGCCAGCCGG + Intergenic
1096681021 12:53255396-53255418 CAATCAGAGGTGAGGCAGGGAGG - Intergenic
1097098858 12:56571847-56571869 CTTTGCAAGGTGAGGATGGCAGG + Exonic
1097500787 12:60398715-60398737 CTTTCAAAGGTCAAGGTGGCAGG + Intergenic
1099227268 12:79984200-79984222 GCATGAAAGGGGAGGCTGGCGGG + Intergenic
1103563932 12:121806097-121806119 ACACCAAAGGTGAGCCTGGCAGG + Exonic
1106354177 13:28963924-28963946 CATTCAAAGGTCAGGCTGGGGGG - Intronic
1106407553 13:29487192-29487214 CAATACCAGGTGAGGCTGGCAGG - Intronic
1106526624 13:30546408-30546430 GTATAAAACGTGAGGTTGGCCGG - Intronic
1107446923 13:40477990-40478012 TAATCAAAGGTGAGGATGGTGGG + Intergenic
1107749452 13:43548748-43548770 CGACCCAAGGTGCGGCTGGCAGG + Intronic
1110226908 13:73129261-73129283 ATATATAATGTGAGGCTGGCTGG - Intergenic
1113323102 13:109256379-109256401 CTATCAGAGGGGAGACTGGGAGG + Intergenic
1118163637 14:63315209-63315231 TTGTCAAAGGCAAGGCTGGCCGG - Intronic
1118709600 14:68508713-68508735 CTCTCAGAGATGAGACTGGCAGG - Intronic
1118767402 14:68919079-68919101 CTACCAAAGGGGAGGAGGGCAGG - Intronic
1118780601 14:69005312-69005334 CTAGGGAAGGTGAGGCTGGGAGG - Intergenic
1119173894 14:72555144-72555166 CTTTCTAAGGTGGGGCAGGCAGG - Intronic
1119268114 14:73277084-73277106 CTTGGAAAGGTGATGCTGGCTGG + Exonic
1121009260 14:90510337-90510359 CCACCAAAGGTGAGGCGGGGTGG - Intergenic
1121519529 14:94576582-94576604 CTCACAAAGGTGATGATGGCTGG - Intronic
1122900375 14:104779877-104779899 GTCCCAAAGCTGAGGCTGGCTGG - Intronic
1122981213 14:105193141-105193163 CTATCGAAGGAGGGGCTGGGTGG - Intergenic
1122997519 14:105273375-105273397 CTCTTAGAGGAGAGGCTGGCGGG - Intronic
1129539278 15:76337959-76337981 CTATGTCAGGTGAGGCCGGCGGG + Exonic
1132985924 16:2767615-2767637 CTAGCACTGGTGAGGCTCGCGGG - Exonic
1134037512 16:11042164-11042186 CTATCCACGTTGAGGCTAGCAGG - Intronic
1136925698 16:34371575-34371597 ATGTCTAAGGTCAGGCTGGCTGG + Intergenic
1136978876 16:35040231-35040253 ATGTCTAAGGTCAGGCTGGCTGG - Intergenic
1138643110 16:58401682-58401704 CAATAAAAGGTGAAGCCGGCTGG - Intronic
1142534009 17:601052-601074 CCACCAAAAGGGAGGCTGGCTGG - Intronic
1142978050 17:3656842-3656864 CTGTCAAAGGTGAGGTGGGGTGG - Intronic
1145290001 17:21535394-21535416 CAACCAGAGGAGAGGCTGGCTGG + Exonic
1145805537 17:27725891-27725913 CTGTGAGAGGTGAAGCTGGCTGG + Intergenic
1146376298 17:32296960-32296982 CTAGAGAAGCTGAGGCTGGCAGG - Intronic
1148192457 17:45689065-45689087 CTATTAAAGGTGATGCTACCTGG - Intergenic
1148217639 17:45842042-45842064 ATTTCAAAGGGGAGGTTGGCAGG - Intergenic
1151423444 17:74014101-74014123 CTAAGAAAGGGGCGGCTGGCTGG + Intergenic
1152132420 17:78485224-78485246 CGATCAGAGGCGAGGGTGGCAGG + Intronic
1152946949 17:83203106-83203128 CGATCCAAGGTGAGGCTGCCAGG + Intergenic
1153083173 18:1252159-1252181 CTATTAGAGGTTAGACTGGCAGG - Intergenic
1158491760 18:57916442-57916464 CTCTCAAAGCTGAGGGAGGCAGG + Intergenic
1162052938 19:8046129-8046151 CTATCAAAGATGATGATCGCTGG - Intronic
1162420170 19:10561653-10561675 CAAGGAAAGGTGAGGCTGGGTGG - Exonic
1162935691 19:13980432-13980454 TTATCAAAGGCCAGGGTGGCAGG + Intronic
1163015420 19:14451404-14451426 CTGTGGAAGGTGGGGCTGGCTGG - Intronic
1163491518 19:17619726-17619748 CTTTAAAAGGTCAGACTGGCTGG - Intronic
1165561941 19:36687626-36687648 CAACCGAAGGTGAGGCTGGTGGG + Intronic
1165856755 19:38883613-38883635 GGATGAAAGGTGAGGCTGGAGGG - Exonic
1167499582 19:49837595-49837617 CCAGGAAAGGTGAGGCTGGGTGG + Intronic
1168355637 19:55698111-55698133 CTATCAGATGTGAGGGTGGCGGG + Intronic
925311378 2:2886307-2886329 ATAACAAAGGTGACGCTTGCTGG - Intergenic
925885233 2:8389820-8389842 CTGGCAAAGGAGAGGATGGCTGG + Intergenic
926436598 2:12844608-12844630 CCACCAAAGATGCGGCTGGCTGG + Intergenic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
932123397 2:69121792-69121814 CAATCAAAGCTGAGGCTTGAAGG + Intronic
933691756 2:85184331-85184353 GTATCAGAGCTGGGGCTGGCAGG + Intronic
934099720 2:88641264-88641286 CTGACAGAGGTGGGGCTGGCTGG - Intergenic
935286310 2:101566749-101566771 TTATCAAAGGAGATGCTGCCAGG - Intergenic
935580154 2:104749821-104749843 CAATTTAAGGGGAGGCTGGCTGG - Intergenic
936071454 2:109374314-109374336 GTATCAGAGCTGAGGCTGCCAGG - Intronic
936235133 2:110735878-110735900 CTCTCTCAGGAGAGGCTGGCTGG + Intronic
939289898 2:140180590-140180612 CTATGAAAGGTGAAACTGGAAGG - Intergenic
939968974 2:148639300-148639322 CTATTAAAGGTGACTTTGGCAGG - Intergenic
939996793 2:148927362-148927384 CTAGCAGAGGTCAGGATGGCTGG + Intronic
943792159 2:191945360-191945382 CTGTCCACGGTGAGGCTGGAAGG + Intergenic
944358608 2:198823542-198823564 CTATGAGAGGTGAAGCTGGCTGG - Intergenic
945194627 2:207226861-207226883 GTATCCAAGGTGTGGCAGGCAGG + Intergenic
946142423 2:217703108-217703130 CTAGGAAAGGTGAGAGTGGCTGG - Intronic
948243217 2:236455981-236456003 CTACAAAAGGAGAGGCTGGCTGG - Intronic
1169210630 20:3764488-3764510 CTGTCGAAGGTGTGGCTGGGAGG - Intronic
1170115732 20:12857587-12857609 CAATGAGAGGTGAAGCTGGCTGG + Intergenic
1170390144 20:15863677-15863699 ATATCACAGGTGACTCTGGCAGG + Intronic
1171114792 20:22515799-22515821 GTACCAAAAGGGAGGCTGGCTGG - Intergenic
1171139444 20:22728508-22728530 CTCCCCAAGGTGTGGCTGGCAGG - Intergenic
1172274663 20:33673212-33673234 CCAGCAAAGGGGAGACTGGCAGG + Intronic
1172536870 20:35680680-35680702 CTATCAAAGGTCTTGCTGGAAGG + Intronic
1172740896 20:37166101-37166123 CAATCAAAGTATAGGCTGGCAGG - Intronic
1173866828 20:46317730-46317752 CTCTGCAAGGTGAGGCTGGTGGG - Intergenic
1173875974 20:46371776-46371798 CCATCTCAGGGGAGGCTGGCGGG - Intronic
1174281592 20:49443789-49443811 CTAACAGAGGGGAGGCTTGCAGG + Intronic
1177371109 21:20204931-20204953 CAATGAGAGGTGAAGCTGGCTGG + Intergenic
1178434858 21:32549155-32549177 CCATGGGAGGTGAGGCTGGCCGG - Intergenic
1178732513 21:35117610-35117632 CTATGCAAGGGGAGGCTGTCTGG - Intronic
1182353247 22:29710587-29710609 CTATCCAAGGTCAGGCGGGAGGG - Intergenic
1183278805 22:36920961-36920983 CTATCAATGGACATGCTGGCTGG - Intronic
1184970889 22:48019125-48019147 CTATAAAAGGCAAGGCTGCCAGG + Intergenic
950674768 3:14548114-14548136 CACTCAAAGGTGAGGTAGGCAGG + Intergenic
955097800 3:55817044-55817066 CTTTCAAAGGTAAGGCTTGTAGG + Intronic
955114316 3:55982068-55982090 GCATAAAAGGAGAGGCTGGCTGG + Intronic
956172066 3:66440856-66440878 ATAGCAAAGGTGATGCAGGCAGG + Intronic
956703573 3:71980380-71980402 ATATGAAAGGAGAGACTGGCCGG - Intergenic
963692761 3:148525435-148525457 CAGTGAAAGGTGAAGCTGGCTGG + Intergenic
964052365 3:152411223-152411245 CTATCAAAACTGAAGATGGCTGG + Intronic
965812945 3:172610451-172610473 CCACCAAAGGTGAGGTTGGGAGG + Intergenic
966831827 3:184017036-184017058 GTATGAAAGGTGAGGCTGCTTGG - Intronic
967751170 3:193118068-193118090 CTGTCACAGGTGTGACTGGCTGG + Intergenic
969581869 4:8070652-8070674 CTGCCACAGGGGAGGCTGGCAGG - Intronic
969605182 4:8198979-8199001 AGATCAGAGCTGAGGCTGGCAGG + Intronic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
983905893 4:173182998-173183020 CTTTGAATGGTGAGGCTAGCAGG + Intronic
985937707 5:3109521-3109543 CTATCAAAGGTGATGTTCACAGG + Intergenic
988106187 5:26751795-26751817 CTATAAATGTTGAGGGTGGCTGG + Intergenic
988838296 5:35056325-35056347 CTTTCAAAGGTGAAGCCAGCAGG + Exonic
991257347 5:64629731-64629753 CTGTCAAAGGGGAGCCTGACAGG + Intergenic
992179223 5:74180508-74180530 TTCTCTAAGGTTAGGCTGGCTGG - Intergenic
996848863 5:127930943-127930965 CTAGCACAGGAAAGGCTGGCAGG - Intergenic
997640382 5:135445074-135445096 CAATCAGAGGTTGGGCTGGCTGG - Exonic
997647573 5:135491316-135491338 CTAACAAAGGAGCGGCTGGATGG - Intergenic
998596350 5:143534555-143534577 CTATCAAAGGTCATGATTGCAGG - Intergenic
999272947 5:150308216-150308238 CTCCCAAAAGTGAGGGTGGCAGG + Intronic
1003558054 6:7158253-7158275 CTTTCAAAGGGGAGGCAGGTGGG - Intronic
1003801078 6:9668152-9668174 CTCTGGAAGGTGAAGCTGGCTGG + Intronic
1004904355 6:20222616-20222638 CTTGCAAAGCTGAGGCTGGAGGG + Intergenic
1006498112 6:34438667-34438689 TAATGAAAGGTGAAGCTGGCTGG + Intergenic
1011382290 6:86755759-86755781 CTATCATAAGTGGGGCTGGCTGG - Intergenic
1012398452 6:98825306-98825328 CTAGGAAAGGTGAGGCTAGGAGG + Intergenic
1013523691 6:110955413-110955435 CTTTCAAAGCTGATGCTGACGGG + Intergenic
1016859150 6:148699176-148699198 CTATTTAGGGTCAGGCTGGCTGG + Intergenic
1017492797 6:154958954-154958976 CTGTCAGAGATGAGGATGGCGGG - Intronic
1017905298 6:158753940-158753962 CTATTAAGGATGAGGCTGGCCGG - Intronic
1024603751 7:51008774-51008796 GTATCAAAGGTGTGTCTGGCTGG - Intergenic
1027759249 7:82256992-82257014 GTATCAATGGTGAGGATGGCAGG + Intronic
1031932603 7:127701315-127701337 CTGTTAATGGTGAGGCTGGTGGG + Exonic
1036590494 8:10163745-10163767 TCATCAAAGGGGAGGATGGCTGG + Intronic
1036744798 8:11399080-11399102 CTAAAAAACCTGAGGCTGGCCGG - Intronic
1038190430 8:25314861-25314883 CTTTCAAAGGTAATGCTGACAGG - Intronic
1040892342 8:52330356-52330378 CTCTCAAAGCTGGGACTGGCAGG - Intronic
1043151800 8:76727101-76727123 CTATCCAAGGTCAAGCTGACTGG + Intronic
1047185204 8:122626886-122626908 CTAACAAAGGCAAAGCTGGCAGG - Intergenic
1047984890 8:130222317-130222339 GAATCAAAGGTTAGGTTGGCAGG - Intronic
1052067416 9:24039293-24039315 CTTTCAAAGTTGAGGGTGACAGG - Intergenic
1055841754 9:80513599-80513621 CTATCAGAGGTGGGGGTGGGAGG - Intergenic
1057142398 9:92735349-92735371 CTATCAAAAGTGGGGATGGGCGG + Intronic
1057518988 9:95746045-95746067 CTACCCAAGGTGAGGCTGTTGGG - Intergenic
1061641492 9:131960947-131960969 CTAGCAGAGGAGAGGCTGCCAGG + Intronic
1061778032 9:132978939-132978961 CTAGGAAAGGTGAGGTGGGCTGG + Intronic
1187316130 X:18196840-18196862 TTATCAAAGATGAGGCAGCCTGG + Intronic
1189309932 X:40012053-40012075 CTTCCAAACGTGAGGCTGACGGG + Intergenic
1191039907 X:56068131-56068153 CTATCAGTGGTGTGGCTGGATGG - Intergenic
1191695488 X:63985739-63985761 CTGGCAGGGGTGAGGCTGGCTGG - Intergenic
1192777796 X:74263170-74263192 CTATCAAAGATGATGCTGTGAGG + Intergenic
1196741285 X:119028415-119028437 CACTGAAAGGTGAAGCTGGCTGG - Intergenic
1197855306 X:130908060-130908082 CTATCAGAGTTGAGTCTGGAGGG + Intergenic
1198197288 X:134376048-134376070 CTATCAAAGCAGAGACTGTCAGG + Intronic
1198400328 X:136262538-136262560 CTATCAAGAGTAAGGCAGGCCGG + Intergenic
1199429233 X:147740309-147740331 CATTCAAGGGTGAGGATGGCAGG - Intergenic