ID: 903970383

View in Genome Browser
Species Human (GRCh38)
Location 1:27115028-27115050
Sequence TGCCCCATCTTTAAAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 1, 2: 4, 3: 41, 4: 343}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903970383_903970388 -4 Left 903970383 1:27115028-27115050 CCACCCACTTTAAAGATGGGGCA 0: 1
1: 1
2: 4
3: 41
4: 343
Right 903970388 1:27115047-27115069 GGCAACTAAGGCTCAGAAAAGGG 0: 1
1: 1
2: 9
3: 128
4: 648
903970383_903970395 30 Left 903970383 1:27115028-27115050 CCACCCACTTTAAAGATGGGGCA 0: 1
1: 1
2: 4
3: 41
4: 343
Right 903970395 1:27115081-27115103 CCAAAGTCACACAGCAAGTGGGG 0: 1
1: 13
2: 65
3: 324
4: 989
903970383_903970387 -5 Left 903970383 1:27115028-27115050 CCACCCACTTTAAAGATGGGGCA 0: 1
1: 1
2: 4
3: 41
4: 343
Right 903970387 1:27115046-27115068 GGGCAACTAAGGCTCAGAAAAGG 0: 1
1: 2
2: 28
3: 201
4: 985
903970383_903970389 0 Left 903970383 1:27115028-27115050 CCACCCACTTTAAAGATGGGGCA 0: 1
1: 1
2: 4
3: 41
4: 343
Right 903970389 1:27115051-27115073 ACTAAGGCTCAGAAAAGGGAAGG 0: 1
1: 1
2: 21
3: 135
4: 730
903970383_903970393 29 Left 903970383 1:27115028-27115050 CCACCCACTTTAAAGATGGGGCA 0: 1
1: 1
2: 4
3: 41
4: 343
Right 903970393 1:27115080-27115102 CCCAAAGTCACACAGCAAGTGGG 0: 2
1: 25
2: 147
3: 479
4: 1295
903970383_903970391 28 Left 903970383 1:27115028-27115050 CCACCCACTTTAAAGATGGGGCA 0: 1
1: 1
2: 4
3: 41
4: 343
Right 903970391 1:27115079-27115101 GCCCAAAGTCACACAGCAAGTGG 0: 2
1: 15
2: 98
3: 361
4: 889
903970383_903970390 1 Left 903970383 1:27115028-27115050 CCACCCACTTTAAAGATGGGGCA 0: 1
1: 1
2: 4
3: 41
4: 343
Right 903970390 1:27115052-27115074 CTAAGGCTCAGAAAAGGGAAGGG 0: 1
1: 0
2: 13
3: 122
4: 721

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903970383 Original CRISPR TGCCCCATCTTTAAAGTGGG TGG (reversed) Intronic
900655759 1:3756032-3756054 TTCTCCATCTTTAAACTGAGAGG - Intronic
901700967 1:11044638-11044660 TGCCCCATCTTCAAAACGGGGGG + Intronic
901736224 1:11313830-11313852 TTCCCCATCTATAAAATGGGAGG - Intergenic
901872986 1:12149105-12149127 TTTCCCATCTGTAAAATGGGAGG - Intergenic
902133430 1:14283407-14283429 TTCCCCATTTTTTAATTGGGTGG - Intergenic
902264382 1:15251295-15251317 TTCCTCATCTATAAAATGGGTGG - Intronic
902405053 1:16177978-16178000 TTCCCTATCTGTAAAGTGGGTGG - Intergenic
902744710 1:18465913-18465935 TTCCCCATCTGTAAAATGGGTGG - Intergenic
902817126 1:18922772-18922794 TGCCCCATCTGTACAATGAGGGG - Intronic
903264705 1:22150836-22150858 AGCCCCATCCTTCAGGTGGGTGG - Intergenic
903281514 1:22252687-22252709 TTCCCCATCTGTAAAATGAGGGG - Intergenic
903287539 1:22286152-22286174 TCCCCCATCTGTTAAATGGGAGG - Intergenic
903408994 1:23124257-23124279 TTCCCCATCTTTAAAATGAAAGG - Intronic
903646903 1:24901560-24901582 TGCCCCATCTGTACAATGAGGGG + Exonic
903776185 1:25795325-25795347 TTGTCCATCTTTGAAGTGGGTGG - Intergenic
903809786 1:26028879-26028901 TTCCTCATCTGTAAAATGGGAGG - Intronic
903853991 1:26325110-26325132 TTCCCCATCTGTAAAATGTGAGG + Intronic
903970383 1:27115028-27115050 TGCCCCATCTTTAAAGTGGGTGG - Intronic
904035197 1:27555298-27555320 TTCCTCATCTGTAAAATGGGAGG - Intronic
904224387 1:29003293-29003315 TTCCTCATCTATAAAATGGGGGG - Intronic
904276609 1:29388906-29388928 TTTCCCATCTGTAAAATGGGGGG + Intergenic
904342259 1:29844335-29844357 TTCCTCATCTGTACAGTGGGAGG + Intergenic
904569114 1:31447688-31447710 TAGCCCATTTTTAAATTGGGAGG + Intergenic
905106101 1:35564479-35564501 TGCCCCATCTGTCAGGTTGGAGG + Intronic
905883971 1:41481913-41481935 TTTCCCATCTGTAAAGTGGTGGG - Intronic
906064944 1:42973998-42974020 TGCTTCATCTGTGAAGTGGGTGG - Intergenic
906657032 1:47555870-47555892 TTCCCCATGTGTAAAGTGAGGGG + Intergenic
906789024 1:48642550-48642572 TTCCCCATCTTTGAAATGTGGGG - Intronic
907172438 1:52481283-52481305 TTCCTCATCTATAAAGTGAGGGG - Intronic
907322482 1:53613836-53613858 TGCCCCATTTGTAAAGAGGCTGG + Intronic
907338128 1:53713962-53713984 TGCCCCAGCTTTAGGGTGTGTGG + Intronic
907410766 1:54281793-54281815 TTCCTCATCTCTAAAATGGGAGG + Intronic
907781514 1:57571370-57571392 TTTCCCATCTGTAAAATGGGTGG - Intronic
908638577 1:66196301-66196323 TGCTTCATCTTTAAAATAGGAGG + Intronic
908879191 1:68711330-68711352 TGATACATCTTAAAAGTGGGGGG - Intergenic
911103980 1:94115928-94115950 TGCTCCATATATAAAGAGGGAGG + Intronic
912527287 1:110292812-110292834 TGCCCCATCTTTAATAGGTGAGG - Intergenic
912650119 1:111430709-111430731 TACCACATCTTTAAAGTGAAGGG + Intergenic
913144186 1:115973056-115973078 TGTCGCATCTTTACAGTAGGAGG - Intergenic
914987301 1:152471994-152472016 TGCCCCATCTGGGAGGTGGGGGG - Intergenic
915119379 1:153619157-153619179 TGCCCCTTCTCTAAAGAAGGAGG + Intronic
915731032 1:158054594-158054616 TTCCCCATCTGTAAAGTGAATGG - Intronic
917645576 1:177025744-177025766 TTCCTTATCTGTAAAGTGGGTGG - Intronic
917755772 1:178095864-178095886 TTCCTCATCTGTAAAGTGAGTGG + Intronic
918489249 1:185062907-185062929 TGCCCAATCTGATAAGTGGGAGG - Intronic
920315824 1:205075026-205075048 TTCCTCATCTGTAAAGTGAGGGG - Exonic
921132392 1:212230866-212230888 TTCCCCATCTATAAAATGGAGGG - Intergenic
921337540 1:214103376-214103398 TTCCTCATCTATAAATTGGGAGG - Intergenic
922593619 1:226797472-226797494 TTCTCCATCTGCAAAGTGGGAGG + Intergenic
924370640 1:243346474-243346496 TGATACATTTTTAAAGTGGGTGG + Intronic
924723437 1:246644889-246644911 TGCCCCATTTTAACAGAGGGAGG + Intronic
1063216126 10:3927173-3927195 TCCCGCATCTGTAAAGTGGTAGG + Intergenic
1063228039 10:4034347-4034369 GGCCCCATCCTTGAAGTAGGGGG - Intergenic
1063949394 10:11208165-11208187 TTTCCCATCTGTAAAATGGGAGG + Intronic
1066226178 10:33385917-33385939 TGCCCCATTTTTAAACAGGTTGG + Intergenic
1068050030 10:51938519-51938541 TTCCCCTTCTTTAAAGTGATTGG + Intronic
1068251509 10:54448452-54448474 TGTTCCATTTTTAAATTGGGAGG + Intronic
1068259978 10:54567158-54567180 TGGCCCATTTTTAAAATGAGTGG + Intronic
1070425858 10:76286406-76286428 TTCCACATTTTTAAAGTGAGAGG + Intronic
1070546718 10:77458307-77458329 TGCCCTATCTTTAGAATGGTTGG - Intronic
1070810757 10:79296621-79296643 TGCCCCATGTTGACCGTGGGGGG - Exonic
1071093828 10:81950391-81950413 TTCCTCATCTGTAAAGTGGAGGG - Intronic
1072846092 10:98832020-98832042 TCCCCCATCAATAAAGTGGTTGG + Intronic
1074770877 10:116732947-116732969 TTCCCCATCTGTAAAATGAGAGG + Intronic
1074946038 10:118281647-118281669 TGCCAAATCTGTAAAATGGGAGG - Intergenic
1075444388 10:122503653-122503675 ATCCACATCTTTAAAATGGGGGG + Intronic
1076550324 10:131273689-131273711 TACCCCATCTTCGCAGTGGGTGG + Intronic
1076576590 10:131473881-131473903 TGCTCCTTCTTTCAGGTGGGAGG - Intergenic
1077460644 11:2707691-2707713 TTTCCCATCTCTACAGTGGGTGG - Intronic
1077685093 11:4283458-4283480 TGCCCCGTCTGGGAAGTGGGGGG + Intergenic
1077690095 11:4334471-4334493 TGCCCCGTCTGGGAAGTGGGGGG - Intergenic
1078723572 11:13906605-13906627 TTCCTCATCTGTAAAGTGAGGGG - Intergenic
1079017323 11:16880188-16880210 TTCCTCATCTGTAAAATGGGGGG + Intronic
1079064228 11:17276109-17276131 TTCCCCATCTTTAAAATGAGGGG + Intronic
1079387968 11:19997740-19997762 TGCCCCATCTCTAAAAGGGGAGG + Intronic
1080280068 11:30546603-30546625 TGGGCCTTCTTTAAAGTGTGTGG + Intronic
1081065895 11:38538456-38538478 AGACCCATCCTTAATGTGGGTGG - Intergenic
1082268752 11:50146733-50146755 TTCCCCATCTTTAAAGTGGGGGG - Intergenic
1082287370 11:50332333-50332355 TCCCCCATCTTTAAAATGGGAGG + Intergenic
1082870959 11:57943780-57943802 TGCCCCATCTGGGAGGTGGGGGG - Intergenic
1083120830 11:60510451-60510473 TGCCCCATCTGGGAGGTGGGGGG + Intergenic
1083164252 11:60873803-60873825 GGTCCCATCTGTTAAGTGGGAGG + Intronic
1083276533 11:61600062-61600084 TTCCCCATCTGTTAAGTGGCTGG + Intergenic
1083535319 11:63461637-63461659 TTCCTCATCTTCAAAGTGTGGGG + Intronic
1083622170 11:64054619-64054641 TTCCTCATCTTTAAAATGGGTGG + Intronic
1084445724 11:69202483-69202505 GTCCTCATCTGTAAAGTGGGGGG + Intergenic
1084460993 11:69296472-69296494 TTCCTCATCTGTTAAGTGGGGGG - Exonic
1084521942 11:69668612-69668634 GGCCTCATCTGTAAAATGGGGGG + Intronic
1084680443 11:70663412-70663434 AGCCTCATCTGTAAAATGGGAGG - Intronic
1084863931 11:72040828-72040850 TGCGCCATCCTTAAAGGGGAGGG - Intronic
1085038714 11:73314486-73314508 TTTCCCATCTGTACAGTGGGAGG + Intronic
1085329674 11:75637665-75637687 TGTCACATCTCTAAAATGGGAGG + Intronic
1085518815 11:77126460-77126482 TGCCCCATCAGTAATGTGCGGGG - Intergenic
1085530255 11:77188173-77188195 CTCCCCATCTGTAAAGTGAGTGG + Intronic
1085717241 11:78883320-78883342 TTCCTCATCTGCAAAGTGGGAGG - Intronic
1089693536 11:120201501-120201523 TATCCCCTCTTTAACGTGGGAGG + Intergenic
1090253158 11:125264865-125264887 GGCCCCATCTGTGAAATGGGAGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1091889869 12:4045005-4045027 TACCCCATCCTGAAAGTGAGAGG + Intergenic
1092800707 12:12163278-12163300 TTCCTCATCTTGAAAATGGGGGG - Intronic
1093980290 12:25468343-25468365 GGCCCCATCTATAAAATGGGTGG + Intronic
1095835197 12:46630220-46630242 TGCCCCATCTCAAAACTGGTAGG - Intergenic
1097606021 12:61755410-61755432 AGCCCCATTCTCAAAGTGGGTGG + Intronic
1101433114 12:104643376-104643398 TTCCTCATCTCTAAAATGGGTGG - Intronic
1101583872 12:106067490-106067512 TGCTCCATCTTGAAAGTAGAGGG + Exonic
1101671613 12:106880435-106880457 CTCCCCATCTATAAAGTGAGTGG - Intronic
1101717362 12:107322020-107322042 TGCCTCATCTGTAAAATAGGGGG + Intronic
1102010594 12:109616169-109616191 TTCCCCACATGTAAAGTGGGGGG + Intergenic
1102164469 12:110795385-110795407 TTCCCCATCCATAAAATGGGTGG - Intergenic
1102410053 12:112709845-112709867 TTCCTCCTCTGTAAAGTGGGGGG - Intronic
1102716330 12:114976202-114976224 CTTCCCATCTGTAAAGTGGGAGG - Intergenic
1103199805 12:119078557-119078579 TGCCTCATCTTGCAAGGGGGAGG + Intronic
1103285178 12:119794910-119794932 TCCCTCATCTGTAAAGTGGAAGG - Intronic
1103778304 12:123382861-123382883 TGCCCCATCTGTAAAATGGGTGG + Intergenic
1109049373 13:57458734-57458756 TGCCCCATCATGCAGGTGGGGGG - Intergenic
1110569193 13:76986521-76986543 TGCCCCATCATTTAAGTGTATGG + Intergenic
1111388784 13:87564028-87564050 GGCACCATCTTTAAAATGGAGGG - Intergenic
1111518068 13:89361675-89361697 TGCCCCAACTGTAAAGCAGGTGG - Intergenic
1112841308 13:103582009-103582031 TCCCTCATATTTAAAATGGGTGG + Intergenic
1113145824 13:107205997-107206019 TGCTTCATCTTTAAAGTGAGGGG - Intronic
1114594275 14:23898349-23898371 TGCCCCATCTGGGAGGTGGGGGG - Intergenic
1118010448 14:61605358-61605380 TGCCACATTTTAAAAGTGAGGGG - Intronic
1118629703 14:67691416-67691438 TGCCCCATAGTAAAAGTAGGTGG - Intronic
1118955593 14:70477700-70477722 TGCCCCATCTGGGAGGTGGGGGG + Intergenic
1120505741 14:85352626-85352648 TGCCCCATCTGGGAGGTGGGGGG - Intergenic
1121182727 14:91941764-91941786 TTCCCCATCTGTAAAATGGGGGG + Intronic
1121341757 14:93109623-93109645 TTCCCCATCCATAAAGTAGGTGG + Intronic
1122146392 14:99691395-99691417 TTCCTCATCTGTAAACTGGGTGG + Intronic
1122154226 14:99740747-99740769 TTCTTCATCTTTAAAATGGGGGG + Intronic
1123722512 15:23072012-23072034 TGGCCCATCTTTAGAGTGGTGGG - Intergenic
1123830783 15:24134814-24134836 TGACCCATTTTTAAAGTCTGTGG + Intergenic
1123835865 15:24192179-24192201 TGACCCATTTTTAAAGTCTGTGG + Intergenic
1124396090 15:29303142-29303164 AGCCCCATATTTCAAGTGGCAGG - Intronic
1125031930 15:35082514-35082536 TGCCCCATCTTGGAGGTGAGGGG + Intergenic
1125927542 15:43575407-43575429 TTCCTCATCTGTAAAATGGGAGG + Intronic
1125940685 15:43674972-43674994 TTCCTCATCTGTAAAATGGGAGG + Intergenic
1128526123 15:68413635-68413657 TTCCCCATCTGTAAAATGAGAGG + Intronic
1128778588 15:70342774-70342796 TTTCCCATCTGTAAAATGGGGGG - Intergenic
1129107840 15:73321551-73321573 TTGCCCATCTGTACAGTGGGAGG - Exonic
1129872037 15:78946679-78946701 TTCCTCATCTGTAAAATGGGGGG - Intronic
1130323187 15:82856987-82857009 TTCCTCATCTGTAAAATGGGGGG + Intronic
1131639067 15:94270300-94270322 TGCTTCATCTGTAAAGTTGGAGG + Intronic
1131878304 15:96834548-96834570 TGTACCATATTTAATGTGGGCGG - Intergenic
1131899833 15:97075421-97075443 TTCTCCATCTTTAAAGAGAGGGG + Intergenic
1133925755 16:10190787-10190809 TTCCTCATCTATAAAATGGGGGG + Intergenic
1133973224 16:10581424-10581446 TTCCCCATCTGGAAACTGGGAGG + Intergenic
1135540117 16:23323539-23323561 TTCCCCATCTGTAAAATGAGGGG - Intronic
1135621499 16:23959863-23959885 GTCCCCATCTGCAAAGTGGGGGG - Intronic
1136009575 16:27354671-27354693 TTCCCCATCTGTATAATGGGAGG + Intronic
1137256288 16:46778079-46778101 TGCCTCCTCTGTAGAGTGGGAGG - Intronic
1137781987 16:51105220-51105242 TTCTCCATTTTTAAAGTGGGTGG + Intergenic
1137811870 16:51360007-51360029 TTCCTTATCTTTAAAATGGGGGG + Intergenic
1138136932 16:54531381-54531403 TTCCCCATCTGTATAATGGGAGG + Intergenic
1138250568 16:55498834-55498856 TTCCTCATCTGTAAAATGGGAGG - Intronic
1140310631 16:73844916-73844938 TGCCCCATTTTTAGAGTTGGAGG - Intergenic
1140816299 16:78624004-78624026 TTCCTCATCTATAAAGTGGATGG - Intronic
1141569243 16:84924389-84924411 GGGCCCCTCTTCAAAGTGGGCGG + Intergenic
1142395717 16:89830043-89830065 TTCCCCATCTTTACAGTCAGAGG - Intronic
1142628751 17:1209666-1209688 TGCACCTGCTTTGAAGTGGGTGG + Intronic
1142954819 17:3514486-3514508 TTCCCCATCTGTCAAATGGGAGG - Intronic
1143175815 17:4954392-4954414 TTCCCCATCTGTAAAATGGGGGG + Intronic
1144058722 17:11562675-11562697 TTCCCCATCTGTAAAATGAGGGG + Exonic
1144852678 17:18251923-18251945 TGACACATCTGTAAATTGGGTGG - Intronic
1146555022 17:33815808-33815830 TTCCCCATCTGTAAAATGAGAGG - Intronic
1147865256 17:43547643-43547665 TGCCTCATCTGTAAAGTGGCGGG - Intronic
1148472766 17:47905777-47905799 TGCCCCAGATTTGAGGTGGGAGG + Intronic
1148772110 17:50073379-50073401 CTCCTCATCTATAAAGTGGGGGG + Intronic
1148960627 17:51389689-51389711 TTCCCCATTTGTAAAGTGAGTGG - Intergenic
1151402259 17:73863462-73863484 TTCCACATCTGTAAAGTGGCAGG - Intergenic
1152489481 17:80620093-80620115 TTCCTCATCCTTAAAGTGAGGGG - Intronic
1156030426 18:32706792-32706814 TGCCTCATCTTTAGGGTGGAGGG - Intronic
1156226456 18:35114022-35114044 TTCCTCAACTTTAAAGTGGAGGG - Intronic
1156824029 18:41408154-41408176 AGCCCCATCTTTAAAAGGGAAGG + Intergenic
1157747179 18:50146229-50146251 TTCCCCATCTCTAAAGTGAGGGG - Intronic
1159043915 18:63350409-63350431 TTCCTCATCTGTAAAATGGGAGG - Intronic
1160037370 18:75314361-75314383 GGCACCATCTTGGAAGTGGGGGG + Intergenic
1160689588 19:455351-455373 TGCCTCATCTATAAAATGGGTGG + Intronic
1161429650 19:4224260-4224282 TTCCCCTTCTGTACAGTGGGAGG + Intronic
1161488245 19:4547554-4547576 TTCCCCGTCTCTAAAATGGGAGG - Intronic
1162312487 19:9915075-9915097 TTCCCCATCTGCAAAGTGGGTGG + Intronic
1162514972 19:11142429-11142451 TTCCCCATCTGTAAAATGGATGG + Intronic
1163470856 19:17496282-17496304 TTCTCCATCTGTAAAGTGGCGGG + Intronic
1163708439 19:18831566-18831588 TTCCCCATCTGTAAAATGGAGGG - Intergenic
1163865562 19:19770260-19770282 CGCCCCATCTGGGAAGTGGGGGG + Intergenic
1164812360 19:31167386-31167408 TACACCATTTTTAAAGTGAGGGG - Intergenic
1164880645 19:31730027-31730049 CTTCCCATCTATAAAGTGGGTGG + Intergenic
1165438244 19:35808641-35808663 TTCCCCATCTAGAAAATGGGGGG - Intronic
1165956302 19:39503891-39503913 TTCCCTATCTGTAAACTGGGGGG + Intronic
1166647254 19:44541288-44541310 TTCCCAATCTGTAAAATGGGGGG - Intergenic
1167747428 19:51360536-51360558 TGCCTCATCTGTAAAATGAGAGG - Intronic
925891410 2:8438072-8438094 TGCAGCATTTTTCAAGTGGGGGG - Intergenic
927462981 2:23315258-23315280 TGTCCCATCATGGAAGTGGGAGG - Intergenic
928082509 2:28323533-28323555 TGCCTCATCTGCAAAGTGAGGGG - Intronic
930258656 2:49119964-49119986 TGACGGCTCTTTAAAGTGGGAGG + Intronic
931129012 2:59312127-59312149 TGCCTCTTCTGTAAAATGGGGGG - Intergenic
932420816 2:71600267-71600289 TTCCCCATTTGCAAAGTGGGTGG + Intronic
932475524 2:72003494-72003516 TTCCCCATCTGTAAAGTGAAGGG - Intergenic
932547653 2:72731547-72731569 GGCCACATCTTTTAAGTGTGTGG - Intronic
932714482 2:74091431-74091453 TGCCTCATCTGTAAAGTGAGGGG - Intronic
935275964 2:101475292-101475314 TTGCCCATTTTTAAACTGGGCGG - Intergenic
935389653 2:102537056-102537078 TGGACAATCTTTAAAGTGGAAGG - Intergenic
942191548 2:173475503-173475525 TTCCTCATCTATAAAATGGGAGG - Intergenic
942441843 2:176045023-176045045 TTCCTCATCTTTAAAATGAGAGG + Intergenic
943021460 2:182579337-182579359 TTGCTCATCTATAAAGTGGGAGG + Intergenic
944703507 2:202265972-202265994 TACGCCATCTTTAAGGTAGGTGG + Exonic
945962302 2:216147987-216148009 TCCTCCATCTTTAGTGTGGGAGG - Intronic
946032580 2:216716788-216716810 TTCCTCATCTGTAAAGTGGGTGG + Intergenic
946080881 2:217117215-217117237 TGCCCCAGATTTAGACTGGGAGG + Intergenic
947342760 2:229157171-229157193 GTCCCCATCTTGAAAGTGGGAGG + Intronic
947477931 2:230468110-230468132 TTCCCCATCTGTCAAATGGGGGG - Intronic
948400220 2:237678951-237678973 TTCCTCATCTGTAAAATGGGAGG - Intronic
1168750451 20:278040-278062 TTCCTCATCTGTAAAATGGGAGG + Intronic
1168961387 20:1872375-1872397 TACCTCATCTGTAAAATGGGAGG + Intergenic
1169154131 20:3314866-3314888 TTCCTCATCTACAAAGTGGGTGG + Intronic
1169209510 20:3758387-3758409 TGCCCCATCTGTCAGATGGGAGG - Intronic
1170268313 20:14494608-14494630 TACCTCATCTTTAAAGTATGAGG + Intronic
1170971988 20:21125295-21125317 TTCCTCATATGTAAAGTGGGAGG - Intergenic
1171055972 20:21906885-21906907 TTGCCCATTTTTAAATTGGGTGG + Intergenic
1172012255 20:31852397-31852419 TTGCTCATCTATAAAGTGGGTGG - Intronic
1172024330 20:31937630-31937652 TTCTCCATCTATAAAGTGGTGGG - Intronic
1172430348 20:34885446-34885468 TTCCCCATCTGTAAAATGAGAGG + Intronic
1173394833 20:42669588-42669610 GGCACCATCTATAAAATGGGAGG - Intronic
1173880635 20:46409220-46409242 TGGCCCATCTTTAGAGTGGTGGG + Intronic
1174830845 20:53811031-53811053 TTCCCCATCTGTAAAATGAGGGG - Intergenic
1174901292 20:54503903-54503925 GACCCCATCTTTGAAGTTGGTGG - Intronic
1180613678 22:17113835-17113857 TTGCTCATCTGTAAAGTGGGTGG + Exonic
1180908993 22:19435339-19435361 TGCACCATCTATAAAGGGGCAGG + Intronic
1181160332 22:20956467-20956489 TGCCCCAGCTTTCCAGTGCGGGG - Intergenic
1181178182 22:21049515-21049537 AGCCACCTCTTTAAAGTAGGGGG - Intronic
1181892152 22:26072800-26072822 TTCCCCATCTGTAAAATGAGGGG + Intergenic
1181984810 22:26792727-26792749 ATCCCCATCTGTAAAATGGGTGG + Intergenic
1181988162 22:26816228-26816250 TGCATCATCTGTAAAATGGGAGG + Intergenic
1182094355 22:27615989-27616011 TCTCCCATCTTTAAAATGGGTGG + Intergenic
1182773223 22:32810960-32810982 TTCCTCATCTCTAAAATGGGGGG + Intronic
1183047359 22:35230799-35230821 TTCCCCAACTTTAAAGGTGGGGG - Intergenic
1183230311 22:36578025-36578047 TCCCTCATCTGTAAAATGGGAGG + Intronic
1183324557 22:37184297-37184319 TTCCCCATCTGCAAAGTGGGAGG + Intronic
1183381970 22:37494728-37494750 TTCCTCATCTGTAAAGTGCGGGG - Intronic
1183735992 22:39645327-39645349 TTCCCCATCTGTAAAATAGGAGG - Intronic
1184150681 22:42636591-42636613 TTCTCCATCTGTAAAATGGGTGG + Intronic
1184710469 22:46246632-46246654 TCCCTCATCTATAAAATGGGTGG + Intronic
1184895073 22:47401903-47401925 TGTCCAATCTTTATAGTGAGTGG - Intergenic
949271960 3:2227581-2227603 TGCCGCAGCATTAAAATGGGTGG - Intronic
950104211 3:10378148-10378170 TACCTCATCTGCAAAGTGGGGGG - Intronic
950226303 3:11237503-11237525 TTCCACATCATTAAAATGGGAGG + Intronic
950502916 3:13375890-13375912 TTCCCCATCTGTAAAGTTGGGGG - Intronic
950642348 3:14356489-14356511 TTCCCCATCTGTAAATTGTGGGG - Intergenic
950678556 3:14569339-14569361 TTCCCCAACTGTAAAATGGGTGG - Intergenic
951290368 3:20866748-20866770 TGCCCCATCTGGGAGGTGGGGGG - Intergenic
952824882 3:37516413-37516435 TTCCTCATCTGTAAAGTGAGAGG + Intronic
952979262 3:38721988-38722010 TTCCCCATCTATATAGTGGGAGG + Intronic
954799210 3:53177497-53177519 TTCCCCATCTGAAAAGTGGGGGG + Intronic
955520559 3:59771543-59771565 TTCCCCATCTGCAAAGTGGGAGG - Intronic
956204877 3:66745002-66745024 TTCCCCTTCTTTAAAGTAGAAGG + Intergenic
956723611 3:72139061-72139083 TGCACCATCTTTTAAGAGGTGGG + Intergenic
956910466 3:73810875-73810897 TCCCCCATCTTTAAAATGGAAGG - Intergenic
956957955 3:74363057-74363079 TTATCCATCTTTAAAATGGGTGG - Intronic
958792629 3:98669559-98669581 TGCCTCATCTTAAAAGTTGGGGG - Intergenic
959377896 3:105607428-105607450 AGACCCATCCTTAATGTGGGTGG - Intergenic
961781514 3:129323440-129323462 TTCCCCATCTGTAAAGTAGGGGG - Intergenic
963095484 3:141534358-141534380 GACCCCATCTTTATAGGGGGGGG + Intronic
963361761 3:144282644-144282666 TGCCCCTCCCTTAAAGGGGGAGG - Intergenic
965008476 3:163056341-163056363 TTACCCATCTAGAAAGTGGGGGG + Intergenic
965136966 3:164784664-164784686 TGCCCCATCTGGGAGGTGGGGGG + Intergenic
965738649 3:171849460-171849482 TGCCTCATTTTAAAAGTGGGAGG + Intronic
967251805 3:187547507-187547529 TTTCTCATCTGTAAAGTGGGGGG + Intergenic
967316368 3:188154615-188154637 TGCCCCAACTGTAAAATGGGAGG - Intronic
968683960 4:1943738-1943760 TTCCCCATCTTTAAATTTCGTGG - Intronic
970193949 4:13538646-13538668 TTACCCATCTGTAGAGTGGGTGG + Intergenic
970513305 4:16802144-16802166 TGCCCCATCTCCACAGTGAGTGG + Intronic
971285212 4:25282324-25282346 TCCTCCATCTTCAAAGTTGGAGG + Intergenic
972310967 4:37882001-37882023 TGCCACAGCATTATAGTGGGAGG - Intergenic
972358671 4:38305892-38305914 TGCACAATTTTTTAAGTGGGGGG + Intergenic
972645714 4:40966435-40966457 TGCCCCACCTTCCAAGTTGGAGG + Intronic
973303214 4:48613573-48613595 TCCCTCATCTGTAAAGTAGGAGG - Intronic
973953655 4:56041564-56041586 TGCCCCAACTTTACCCTGGGAGG + Intergenic
975697197 4:77024833-77024855 TTCCCCATCTATAAAGTGGGAGG + Intronic
978376265 4:108077730-108077752 TGCCCCATCTGGGAAGTGAGGGG + Intronic
978407948 4:108399433-108399455 TGCCCCAAATGTGAAGTGGGTGG + Intergenic
979488577 4:121297676-121297698 TGCCTCATCTGTCAAGTGAGGGG + Intergenic
979859144 4:125671956-125671978 AGCCTCATGTTTTAAGTGGGAGG - Intergenic
980091910 4:128451640-128451662 TGCCCCATCTGTGAAATGAGAGG - Intergenic
981902507 4:149883113-149883135 TTCCTCATCTGTAAAATGGGGGG + Intergenic
982265045 4:153530817-153530839 TGCCACATCAGGAAAGTGGGGGG - Intronic
982283442 4:153709978-153710000 TTCAACATCTTTAAAGTAGGTGG - Intergenic
989138174 5:38175957-38175979 TTCACCATCTTGAAAGTGGCTGG - Intergenic
989663453 5:43824553-43824575 TGCCCCATCTGGGAGGTGGGGGG - Intergenic
990109948 5:52310296-52310318 TTCCCCATCTATAAAGGTGGAGG + Intergenic
990709077 5:58563174-58563196 TGCCCCGTCTGGGAAGTGGGGGG - Intergenic
990710036 5:58570429-58570451 TTGCTCATCTTTAAAATGGGGGG + Intergenic
990729646 5:58794725-58794747 TTCTCCATCTGTAAAATGGGGGG - Intronic
992879381 5:81091143-81091165 TTCCCCATCTGTGAAATGGGAGG + Intronic
994323137 5:98416092-98416114 CGCCCCATCCTTAAAGGTGGTGG + Intergenic
994665907 5:102705045-102705067 CGCTCCATCTCTAAAGAGGGTGG + Intergenic
994704854 5:103190897-103190919 TGCCCTATCTTTAAAGCAAGTGG + Exonic
995954966 5:117766590-117766612 TGCCCCAACGTTGAAGTGAGAGG - Intergenic
996270542 5:121599110-121599132 TGCCCTCTCTTTAATGTGGTTGG + Intergenic
996711777 5:126550651-126550673 TGCCCAATCTGTAAATTGGGAGG - Intronic
997048095 5:130344348-130344370 TTGCCCATTTTTAAATTGGGTGG + Intergenic
997310229 5:132873680-132873702 TGCCACATCTTGACAGGGGGAGG - Exonic
997433373 5:133856973-133856995 TATCCCACCTGTAAAGTGGGTGG + Intergenic
998077922 5:139251439-139251461 TTCTCCATCTGTAAAATGGGCGG + Intronic
998951899 5:147401012-147401034 TACCCCATCTAGAAAGTGAGGGG + Intronic
999330998 5:150673209-150673231 TGCCCCACCTGTAAAATGAGGGG + Intronic
999377901 5:151099714-151099736 TACTCCAACTTTATAGTGGGGGG - Intergenic
999381672 5:151125825-151125847 GTCTCCATCTTTAAAGTGAGGGG - Intronic
999854975 5:155584296-155584318 TTCCTCATCTGTAAAGTGAGGGG + Intergenic
1000038685 5:157468517-157468539 TTCACCATCTTTAAAGTGGAAGG + Intronic
1001326699 5:170733428-170733450 TTTCCCATCTGCAAAGTGGGAGG - Intronic
1001399982 5:171440668-171440690 TTCCCCACCTGTAATGTGGGTGG + Intronic
1001532641 5:172474967-172474989 TTCCCCATCTGTGAAATGGGAGG - Intergenic
1002102919 5:176866238-176866260 TACCCCATCTTTGATGTGAGGGG - Intronic
1003393099 6:5730081-5730103 TGGCATATCTTTAAAATGGGTGG - Intronic
1004190984 6:13463244-13463266 TGCAGCATCTGTAAACTGGGAGG - Intronic
1004833831 6:19507958-19507980 AGACCCATCTTTAATCTGGGTGG - Intergenic
1004879906 6:19996953-19996975 CACCTCATCTTTAAAGGGGGAGG + Intergenic
1004925285 6:20410426-20410448 TTCCTCATCTGTAAATTGGGAGG + Intronic
1004998045 6:21213190-21213212 TTCCTCATCTATAAATTGGGAGG + Intronic
1006738739 6:36292826-36292848 TGTCCCAGCTTTAAAGCAGGAGG - Intronic
1006812130 6:36826874-36826896 TTCCCCATCTGTAAAGTGGGGGG + Intronic
1006994153 6:38242472-38242494 TGTCTCATCTGTAAAATGGGAGG + Intronic
1007261480 6:40567052-40567074 TTCCTCATCTTTAAAATTGGGGG - Intronic
1008367754 6:50702657-50702679 TGCCCAATCTTTAAGGAGTGAGG - Intergenic
1008909940 6:56721193-56721215 TGCCCCATCTGGGAGGTGGGGGG - Intronic
1009392913 6:63164520-63164542 TGCCCCGTCTGGGAAGTGGGGGG + Intergenic
1013823190 6:114180055-114180077 AGCCCCATCCTCAATGTGGGTGG - Intronic
1015117220 6:129663031-129663053 TTCCTCATCCTTAAAATGGGGGG - Intronic
1015472998 6:133627600-133627622 TTCCTCATCTATTAAGTGGGGGG + Intergenic
1017427155 6:154334357-154334379 TTCCCCATCCATAAAGTGGAAGG + Intronic
1019325010 7:433698-433720 GGCCCCATCTTTAACCTGAGAGG - Intergenic
1020858415 7:13457388-13457410 TGACCCAGATTTAAAGTGAGGGG + Intergenic
1022524634 7:31029081-31029103 TTCCCCATCTATCAAATGGGAGG + Intergenic
1022853266 7:34288718-34288740 TGCCCATTTTTTAAATTGGGTGG - Intergenic
1023553098 7:41389688-41389710 TTCCCCATCTGGAAAGTGGGAGG - Intergenic
1023615545 7:42016041-42016063 TGCCAGTTCTTTATAGTGGGAGG - Intronic
1023969401 7:44979825-44979847 TGCCTCATCTTCAAAGTGCAGGG - Intergenic
1026587887 7:71671639-71671661 TCCCTCATCTATAAAATGGGAGG + Intronic
1027826789 7:83125332-83125354 CGCCCCATCTGGGAAGTGGGGGG + Intronic
1028710500 7:93902332-93902354 AGACCCATCTTTAATCTGGGCGG - Intronic
1029250368 7:99232247-99232269 TTTCCCATCTGTAAAGTGGGTGG - Intergenic
1029899151 7:104021820-104021842 TGCCCCATCTTGGAAGGGGTGGG - Intergenic
1030552412 7:110979738-110979760 TGTCCCATTTTTCAAGTGGTTGG - Intronic
1032196831 7:129794294-129794316 TTCCCCACCTGTGAAGTGGGTGG - Intergenic
1033638832 7:143240599-143240621 TTCATCATCTTTAAAATGGGGGG + Intergenic
1035108287 7:156459932-156459954 TTCCTCATCTTTAAAATGAGGGG + Intergenic
1035110134 7:156475030-156475052 TTCCTCATCTTTAAAGTGAAGGG - Intergenic
1035578606 8:725379-725401 TGGCTCATCTGTAAAGTGGGCGG - Intronic
1037222886 8:16546983-16547005 TGCCCTATCTTTCTATTGGGTGG - Intronic
1037348095 8:17921599-17921621 TGCCCCATCTATGAAATGAGGGG - Intergenic
1040548840 8:48423012-48423034 TGCCCCAAGTTTAATGTGCGAGG + Intergenic
1041133403 8:54728487-54728509 TGCCCTATCCCAAAAGTGGGTGG - Intergenic
1043679421 8:83003185-83003207 TTCCTCATCTTTAAAATGGATGG + Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1044298959 8:90561644-90561666 TTCTTCATCTCTAAAGTGGGGGG + Intergenic
1044581913 8:93833494-93833516 CGCCCCATCTGGGAAGTGGGGGG - Intergenic
1044597172 8:93970629-93970651 TGCCCCATCTCGGAGGTGGGGGG - Intergenic
1045021897 8:98051781-98051803 TGCCCCATCTGGGAGGTGGGGGG - Intergenic
1046118508 8:109814561-109814583 CTCCCCAGCTTTCAAGTGGGAGG - Intergenic
1047505320 8:125475171-125475193 TTCCCAATCTGTAAAATGGGGGG - Intergenic
1049161102 8:141098460-141098482 TTTCTCATCTGTAAAGTGGGTGG - Intergenic
1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG + Intergenic
1052104379 9:24494470-24494492 TTCTTCATCTATAAAGTGGGAGG - Intergenic
1053304859 9:36977235-36977257 TTCCTCATCTGTAAAATGGGAGG - Intronic
1054731090 9:68703885-68703907 TTCCTCATCTGTAAAGCGGGAGG + Intergenic
1055241845 9:74195826-74195848 TACCCCATCTTTAAAGAGATTGG + Intergenic
1055465535 9:76561803-76561825 TTCCTCATCTGTAAAATGGGAGG - Intergenic
1056462531 9:86822216-86822238 TTCATCATCTGTAAAGTGGGAGG - Intergenic
1058866492 9:109166665-109166687 CTCCCCATCTGTAAAGCGGGCGG + Intronic
1059342109 9:113603094-113603116 TTCCCCATCTTAAAAATGGGTGG + Intergenic
1059389155 9:113988067-113988089 TTCCCCAACTGTAAAATGGGTGG + Intronic
1060518326 9:124279627-124279649 TGCCCCACCTGTGCAGTGGGAGG + Intronic
1060940296 9:127539586-127539608 TTTCCCACCTTTAAAATGGGAGG + Intronic
1061275675 9:129568562-129568584 TTCCCCATCTGTAAACTGGGTGG - Intergenic
1061756083 9:132813399-132813421 TGCTCCATCTAGAAAGTGGTAGG + Intronic
1187433108 X:19242677-19242699 TGAAGCATCTTTACAGTGGGTGG + Intergenic
1187441989 X:19328947-19328969 TGGCTCATCTGTGAAGTGGGAGG + Intergenic
1187592609 X:20734875-20734897 TTCCCCTTCTTTAAAATGAGAGG - Intergenic
1190877001 X:54467133-54467155 TTCCTCATCTATAAAATGGGGGG - Intronic
1190906912 X:54736795-54736817 TGCCCCATCTGGGATGTGGGTGG + Intergenic
1191705847 X:64093856-64093878 TGCCCCAGCCTCAAAGTAGGAGG - Intergenic
1192189963 X:68984985-68985007 TTCCCTATCTGTAAAATGGGGGG - Intergenic
1192505116 X:71676552-71676574 TGCCCCGTCTGGGAAGTGGGGGG + Intergenic
1192739973 X:73882579-73882601 TGCCCCATCTGGGAGGTGGGGGG + Intergenic
1192849034 X:74934303-74934325 TTCCCCAACTGTAAAGTGGGAGG + Intergenic
1192885722 X:75334909-75334931 CGCCCCATCTGGGAAGTGGGGGG - Intergenic
1196669506 X:118350440-118350462 TTCCTCATCTTTAAATTGAGGGG + Intronic
1197762853 X:130039836-130039858 TGCCCCTTCTGTAAAGTGTCTGG + Intronic
1198055181 X:132987145-132987167 TTCCCCATCTGTAAAATGTGTGG + Intergenic
1198109054 X:133486805-133486827 AGACCCATCCTTAATGTGGGTGG - Intergenic
1200527803 Y:4295686-4295708 TGCCCCATCTGAGAAGTGAGGGG + Intergenic