ID: 903970498

View in Genome Browser
Species Human (GRCh38)
Location 1:27115691-27115713
Sequence CTAGTTAGGAGGGCCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1208
Summary {0: 1, 1: 0, 2: 1, 3: 98, 4: 1108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903970491_903970498 23 Left 903970491 1:27115645-27115667 CCACTTAAAAAAAATAGCTGGGC 0: 1
1: 2
2: 10
3: 88
4: 430
Right 903970498 1:27115691-27115713 CTAGTTAGGAGGGCCGAGGCAGG 0: 1
1: 0
2: 1
3: 98
4: 1108
903970494_903970498 -10 Left 903970494 1:27115678-27115700 CCTGTAGTCTCAGCTAGTTAGGA 0: 5
1: 223
2: 8441
3: 113652
4: 286605
Right 903970498 1:27115691-27115713 CTAGTTAGGAGGGCCGAGGCAGG 0: 1
1: 0
2: 1
3: 98
4: 1108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903970498 Original CRISPR CTAGTTAGGAGGGCCGAGGC AGG Intronic
900221250 1:1510424-1510446 CCAGTTTGGGAGGCCGAGGCAGG - Intergenic
901095650 1:6677061-6677083 CTACTCAGGAAGGCTGAGGCAGG + Intronic
901302769 1:8211537-8211559 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
901357866 1:8667427-8667449 CATGTTCGGGGGGCCGAGGCAGG + Intronic
901553095 1:10010693-10010715 CTACTTGGGAAGGCTGAGGCAGG - Intronic
901600377 1:10419118-10419140 CTACTTAGGAAGGCTGGGGCAGG - Intronic
902325253 1:15695911-15695933 CTATTCAGGAGGGCTGAGGTAGG - Intronic
902578176 1:17391702-17391724 CTACTGTGGGGGGCCGAGGCAGG + Intronic
903025616 1:20428022-20428044 CTACTCAGGGGGGCTGAGGCAGG + Intergenic
903062593 1:20680463-20680485 GCAGTTTGGAAGGCCGAGGCGGG + Intronic
903851334 1:26308153-26308175 CTACTCAGGAAGGCTGAGGCAGG + Intronic
903855461 1:26335363-26335385 CTACTTGGGAAGGCTGAGGCAGG + Intronic
903970498 1:27115691-27115713 CTAGTTAGGAGGGCCGAGGCAGG + Intronic
904017627 1:27435056-27435078 CTACTTGGGAAGGCTGAGGCAGG - Intronic
904190797 1:28742159-28742181 CTACTTGGGAGGCCTGAGGCAGG - Intronic
904662631 1:32096569-32096591 CTACTTGGGAGGCCCGAGGCAGG - Intronic
904691744 1:32298197-32298219 CTACTCAGGAAGGCTGAGGCAGG - Intronic
904738420 1:32652650-32652672 CTACTTGGGAGGGCTTAGGCAGG - Intronic
905067691 1:35197221-35197243 CTACTTTGGGAGGCCGAGGCAGG + Intergenic
905069953 1:35216878-35216900 CTACTTGGGGGGGCTGAGGCAGG - Intergenic
905079976 1:35310039-35310061 CTACTGAGGAGGCCTGAGGCAGG - Intronic
905136638 1:35805631-35805653 GCAGTTTGGAAGGCCGAGGCGGG + Intergenic
905148173 1:35904349-35904371 GTACTTTGGAAGGCCGAGGCGGG - Intronic
905154263 1:35961195-35961217 CCACTTTGGGGGGCCGAGGCAGG - Intronic
905409251 1:37756935-37756957 CTACTTGGGAGGGCTGAGGTGGG - Intronic
905542881 1:38774184-38774206 CTACTTGGGAGGCCTGAGGCAGG - Intergenic
905696635 1:39979454-39979476 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
905735318 1:40320989-40321011 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
905760287 1:40550827-40550849 GTACTTAGGGAGGCCGAGGCGGG + Intergenic
906151396 1:43589748-43589770 CTACTTGGGAGGGCTGAGACAGG + Intronic
906156076 1:43614738-43614760 CTATTTGTGAGGGCTGAGGCAGG + Intronic
906158438 1:43628487-43628509 GCACTTAGGAAGGCCGAGGCGGG - Intergenic
906235337 1:44204163-44204185 GCACTTTGGAGGGCCGAGGCAGG - Intergenic
906298719 1:44665388-44665410 GTATTTTGGAAGGCCGAGGCAGG + Intronic
906450616 1:45943632-45943654 CTACTCAGGAAGGCTGAGGCAGG + Intronic
906483134 1:46214097-46214119 ATACTTTGGAAGGCCGAGGCTGG + Intronic
906612833 1:47215036-47215058 ACAGATAGGAGGGCAGAGGCAGG - Intergenic
906618844 1:47256881-47256903 CTACTCAGGAAGGCTGAGGCAGG + Intronic
906900295 1:49828822-49828844 GTATTTTGGAAGGCCGAGGCGGG + Intronic
907357313 1:53886804-53886826 CTAGATAGGATGGCTGAGGAGGG + Intronic
907445548 1:54505443-54505465 CTACTTTGGGAGGCCGAGGCAGG + Intergenic
907655907 1:56341624-56341646 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
907769516 1:57446484-57446506 CTACTTGGGAAGGCTGAGGCGGG + Intronic
908153450 1:61328530-61328552 CTACTCGGGAGGGCTGAGGCAGG - Intronic
908195225 1:61741443-61741465 GTACTTTGGAAGGCCGAGGCGGG - Intergenic
908204452 1:61831074-61831096 CTACTTGGGGGGGCTGAGGCAGG + Intronic
908487017 1:64604895-64604917 GTACTTTGGAAGGCCGAGGCGGG - Intronic
908550468 1:65203691-65203713 CTACTTGGGAGGGCTGAGGCAGG + Intronic
908918951 1:69167070-69167092 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
909176002 1:72360030-72360052 GTAGTTTGGGAGGCCGAGGCGGG + Intergenic
909371844 1:74892616-74892638 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
909420834 1:75463173-75463195 GTACTTTGGAAGGCCGAGGCAGG + Intronic
910243557 1:85114686-85114708 CTAGTTAACAGGGCCAAGTCTGG - Intronic
912366442 1:109137637-109137659 CTACTTAGGAAGGCTGAGGCAGG - Intronic
912583539 1:110741125-110741147 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
913473438 1:119213817-119213839 GCAGTTTGGAAGGCCGAGGCAGG - Intergenic
913676689 1:121147335-121147357 GTACTTTGGGGGGCCGAGGCGGG + Intergenic
913965589 1:143374646-143374668 GCACTTTGGAGGGCCGAGGCAGG - Intergenic
914059963 1:144200248-144200270 GCACTTTGGAGGGCCGAGGCAGG - Intergenic
914119187 1:144766121-144766143 GCACTTTGGAGGGCCGAGGCAGG + Intergenic
914252671 1:145934595-145934617 ATAGTTTGGGAGGCCGAGGCAGG + Exonic
914818877 1:151084331-151084353 CTACTCAGGAAGGCTGAGGCAGG - Intronic
914849022 1:151300493-151300515 CTACTTGGGAAGGCTGAGGCAGG + Intronic
914893050 1:151644908-151644930 CTACTCAGGAGGGCTGAGGCAGG - Intronic
915154459 1:153863232-153863254 ACAGTTTGGGGGGCCGAGGCGGG + Intronic
915217129 1:154347827-154347849 CTACTTGGGAAGGCTGAGGCAGG + Intronic
915364645 1:155308170-155308192 CCACTCAGGAGGGCTGAGGCGGG - Intergenic
915423745 1:155806541-155806563 GCAGTTAGGAAGGCCAAGGCAGG - Intronic
915515772 1:156411626-156411648 GTACTTTGGGGGGCCGAGGCGGG + Intronic
915812220 1:158925406-158925428 CTAGTTTGGGAGGCTGAGGCGGG - Intergenic
916036432 1:160926664-160926686 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
916648913 1:166816895-166816917 CTAGTTGGCAGGGCAGGGGCAGG - Intergenic
916912061 1:169361531-169361553 GCAGTTTGGAAGGCCGAGGCAGG + Intronic
916936913 1:169638350-169638372 CTACTCAGGAAGGCTGAGGCGGG + Intergenic
917088049 1:171323415-171323437 ATACTTTGGAAGGCCGAGGCAGG + Intronic
917098447 1:171422981-171423003 GCAGTTTGGAGGGCCAAGGCAGG + Intergenic
917131861 1:171751313-171751335 CTACTTTGGGAGGCCGAGGCGGG - Intergenic
917392007 1:174547368-174547390 GTACTTTGGAAGGCCGAGGCAGG + Intronic
917554987 1:176075756-176075778 GTAGTTTGGGAGGCCGAGGCAGG + Intronic
917608977 1:176667132-176667154 CTACTCAGGAAGGCTGAGGCAGG + Intronic
917851501 1:179068678-179068700 GTAGTTTGGGAGGCCGAGGCAGG - Intronic
917998110 1:180462123-180462145 CTATTTAGGGAGGCTGAGGCAGG + Intronic
918171240 1:181999362-181999384 CTACTCCGGAGGGCTGAGGCAGG - Intergenic
918204624 1:182297994-182298016 GTACTTTGGAAGGCCGAGGCGGG - Intergenic
918231232 1:182534579-182534601 GTAGTTTGGTAGGCCGAGGCCGG + Intronic
918318155 1:183340432-183340454 CTACTTAGGGAGGCTGAGGCAGG - Intronic
918652296 1:186980183-186980205 GCACTTAGGAAGGCCGAGGCGGG - Intronic
918709475 1:187708754-187708776 CAACTTAGGGAGGCCGAGGCAGG - Intergenic
918794546 1:188875174-188875196 GTAGTTTGGGGGGCCAAGGCAGG - Intergenic
918859917 1:189810681-189810703 CTGCTCAGGAGGGCTGAGGCAGG - Intergenic
919023986 1:192144982-192145004 GCAGTTTGGAAGGCCGAGGCGGG - Intergenic
919291731 1:195642359-195642381 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
919300129 1:195751343-195751365 CTACTTTGGGAGGCCGAGGCAGG - Intergenic
920027074 1:203006851-203006873 GTACTTTGGAAGGCCGAGGCGGG - Intergenic
920092961 1:203467148-203467170 GCACTTAGGAAGGCCGAGGCGGG + Intergenic
920160290 1:203992374-203992396 CAATTTGGGAGGCCCGAGGCAGG - Intergenic
920237539 1:204518264-204518286 CTATTCCGGAGGGCTGAGGCAGG - Intronic
920289790 1:204912448-204912470 CTACTCAGGGGGGCTGAGGCAGG + Intronic
920295428 1:204953406-204953428 CTACTTGGGAGGGCTGAGGCAGG - Intronic
920330203 1:205201946-205201968 CTACTCAGGAAGGCTGAGGCAGG + Intronic
920333625 1:205229430-205229452 GCACTTAGGAAGGCCGAGGCGGG - Intronic
920464050 1:206166176-206166198 GTACTTTGGGGGGCCGAGGCAGG + Intergenic
920522533 1:206638989-206639011 CTACTCAGGAAGGCTGAGGCAGG - Intronic
921395344 1:214663247-214663269 CTAGTTAGGACAACAGAGGCAGG + Intronic
921862575 1:220054944-220054966 CTACTTGGGGGGGCTGAGGCAGG + Intergenic
922495973 1:226058279-226058301 CTACTTGGGAGGCCTGAGGCAGG - Intergenic
922633532 1:227140104-227140126 CTAGTAAAGAGGGCCGTGGTTGG - Intronic
923061994 1:230484163-230484185 ATACTTTGGAAGGCCGAGGCAGG + Intergenic
923104774 1:230845569-230845591 CTACTCAGGAAGGCTGAGGCAGG + Intronic
923120918 1:230990664-230990686 CTACCTGGGGGGGCCGAGGCAGG - Intronic
923566545 1:235080691-235080713 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
923703922 1:236327716-236327738 CTACTCAGGAGGACTGAGGCAGG - Intergenic
924301611 1:242644985-242645007 CTACTTGGGGGGGCTGAGGCAGG - Intergenic
924693416 1:246374844-246374866 GCAGTTTGGGGGGCCGAGGCAGG + Intronic
1062985745 10:1766808-1766830 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1063208713 10:3858783-3858805 CTAGTTAGGATGGCCCGGGTGGG - Intergenic
1063355921 10:5398172-5398194 GTAGTTTGGGAGGCCGAGGCAGG + Intronic
1063992140 10:11577745-11577767 GTACTTTGGGGGGCCGAGGCAGG - Intronic
1064026841 10:11855675-11855697 CTACTTGGGAGGCCTGAGGCAGG + Intronic
1064172430 10:13045976-13045998 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1064742359 10:18446816-18446838 GCAGTTTGGAAGGCCGAGGCAGG + Intronic
1064948617 10:20820577-20820599 ACAGTTTGGAAGGCCGAGGCAGG + Intronic
1064996789 10:21303102-21303124 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1065568358 10:27040917-27040939 CTACTTGGGGGGGCCGAGGCAGG + Intronic
1065667628 10:28079873-28079895 TCACTTAGGAAGGCCGAGGCGGG + Intronic
1066007479 10:31158888-31158910 CCACTTTGGGGGGCCGAGGCGGG - Intergenic
1066101996 10:32125875-32125897 CTACTCAGGAGGCCTGAGGCAGG + Intergenic
1066246930 10:33592780-33592802 CTACTTGGGAGTGCTGAGGCAGG - Intergenic
1066359926 10:34720184-34720206 CTAGTTTGGGAGGCCCAGGCAGG + Intronic
1066446897 10:35491858-35491880 GCACTTTGGAGGGCCGAGGCGGG - Intronic
1066492583 10:35907758-35907780 CAATTCAGGAGGGCGGAGGCGGG - Intergenic
1067109982 10:43393482-43393504 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1067266997 10:44755196-44755218 CTACTCAGGAGGGCTGAGGTGGG - Intergenic
1067376266 10:45730233-45730255 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1067883965 10:50070918-50070940 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1068111698 10:52687962-52687984 GGAGTTTGGAAGGCCGAGGCAGG + Intergenic
1069011486 10:63378343-63378365 GCACTTTGGAGGGCCGAGGCGGG + Intronic
1069022987 10:63510112-63510134 CTACTTGGGGGTGCCGAGGCAGG - Intergenic
1069062256 10:63906457-63906479 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1069436880 10:68392277-68392299 CCACTTTGGAAGGCCGAGGCGGG - Intronic
1069586815 10:69611895-69611917 GCAGTTTGGAAGGCCGAGGCAGG + Intergenic
1069702571 10:70437327-70437349 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1069970615 10:72165224-72165246 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1069986714 10:72289347-72289369 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1070176255 10:73972647-73972669 CTACTTTGGGAGGCCGAGGCGGG - Intergenic
1070233593 10:74598559-74598581 CTACTTGGGAGGGCTGAGGCAGG - Intronic
1070592192 10:77809158-77809180 GCAGTTTGGAAGGCCGAGGCGGG + Intronic
1070982950 10:80664873-80664895 GTACTTAGGAAGGCTGAGGCGGG - Intergenic
1071496771 10:86173283-86173305 GTACTTTGGAAGGCCGAGGCAGG - Intronic
1071923204 10:90374729-90374751 CTAGTTAGGAGGGCTGATTAGGG + Intergenic
1072081002 10:92032124-92032146 CTACTCAGGAGGGCTGGGGCAGG - Intergenic
1072354100 10:94589034-94589056 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1072384044 10:94905382-94905404 CCACTTTGGAAGGCCGAGGCAGG + Intergenic
1072418114 10:95265788-95265810 CTACTTGAGAGGGCTGAGGCAGG + Intronic
1072515422 10:96176783-96176805 CTACTCAGGAGGGCTGACGCAGG + Intronic
1072623641 10:97097079-97097101 CTAGTGAGGAGCCCGGAGGCAGG - Intronic
1072670032 10:97422590-97422612 GTACTTTGGAAGGCCGAGGCGGG + Intronic
1072983713 10:100121511-100121533 GTACTTTGGAAGGCCGAGGCGGG + Intergenic
1073279282 10:102340382-102340404 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1073294397 10:102430278-102430300 CTACTCAGGAGGGCTGAGGCAGG - Intronic
1073382589 10:103091144-103091166 CTAATTAGGGTGGCTGAGGCAGG - Intronic
1073388616 10:103151351-103151373 CTACTAAGGAAGGCTGAGGCAGG + Intronic
1073409133 10:103325021-103325043 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1073797495 10:107004062-107004084 CTAGTTTGGAAGGCTGAGGCAGG + Intronic
1073963016 10:108955162-108955184 CTACTTAGGGAGGCTGAGGCCGG + Intergenic
1074329058 10:112485168-112485190 CTACTTCGGAAGGCAGAGGCAGG + Intronic
1074374039 10:112924269-112924291 CTACTCAGGAGCGCTGAGGCAGG + Intergenic
1074380779 10:112978575-112978597 CTACTCGGGAGGGCTGAGGCAGG - Intronic
1074472233 10:113737913-113737935 CTAGTTGGGCAGGCTGAGGCAGG - Intergenic
1074566989 10:114588749-114588771 ATACTTTGGAAGGCCGAGGCTGG - Intronic
1074568273 10:114601374-114601396 CTACTCTGGAGGGCTGAGGCAGG - Intronic
1074604881 10:114952190-114952212 ATACTTTGGAAGGCCGAGGCGGG + Intronic
1074835776 10:117291596-117291618 CTACTAAGGAGGGCTGAGGTGGG + Intronic
1075033707 10:119044600-119044622 GCAGTTTGGAAGGCCGAGGCAGG + Intronic
1075604003 10:123791303-123791325 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1075674054 10:124283557-124283579 CTAATAAGGACGGCTGAGGCAGG + Intergenic
1075787968 10:125062749-125062771 CTACTCAGGAGGGTTGAGGCAGG + Intronic
1075871887 10:125777178-125777200 CTACTTAGGGGAGCTGAGGCTGG + Intergenic
1076046605 10:127299348-127299370 GCACTTTGGAGGGCCGAGGCAGG - Intronic
1077089206 11:770800-770822 CTTGTCAGGAGGGAAGAGGCGGG + Exonic
1077333042 11:1991693-1991715 CATGTTGGGAGGGCCGAGGAGGG + Intergenic
1077366363 11:2162880-2162902 CCAGGTAGGAGGGCAGAGCCAGG + Intergenic
1077598331 11:3554002-3554024 CTACTCAGGAGGGCTGAGGTGGG + Intergenic
1077623374 11:3748317-3748339 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1077684227 11:4275938-4275960 CTACTCTGGAGGGCTGAGGCAGG - Intergenic
1077685814 11:4290830-4290852 CTACTCTGGAGGGCTGAGGCAGG + Intergenic
1077690963 11:4341990-4342012 CTACTCTGGAGGGCTGAGGCAGG + Intergenic
1077730816 11:4727561-4727583 GCAGTTTGGAAGGCCGAGGCGGG + Intronic
1077816743 11:5693131-5693153 GCAGTTTGGGGGGCCGAGGCGGG - Intronic
1078152448 11:8770799-8770821 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1078479466 11:11663462-11663484 CTAGGCAGGAAGGCTGAGGCAGG + Intergenic
1078847003 11:15127399-15127421 CTAGTGGGGAGGGCTGAAGCTGG + Intronic
1078934505 11:15939566-15939588 CTAGGGAGGAGGGAAGAGGCTGG + Intergenic
1079207141 11:18425827-18425849 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1080139955 11:28904768-28904790 CTAGTTGGGGAGGCTGAGGCAGG + Intergenic
1080412406 11:32038181-32038203 GCACTTTGGAGGGCCGAGGCAGG - Intronic
1080535601 11:33218589-33218611 GCAGTTTGGAAGGCCGAGGCGGG + Intergenic
1080536551 11:33227270-33227292 CTACTTGGGAGGGCTGAGGCAGG + Intergenic
1080789279 11:35507156-35507178 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1080832893 11:35912683-35912705 CTACTTAAGAAGGCTGAGGCAGG + Intergenic
1081790928 11:45784141-45784163 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1082026540 11:47576785-47576807 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1082860988 11:57856617-57856639 ACAGTTTGGAAGGCCGAGGCGGG - Intergenic
1082928150 11:58573132-58573154 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1083354765 11:62058039-62058061 GTACTTTGGAAGGCCGAGGCGGG - Intergenic
1083557228 11:63640172-63640194 CCAGTTTGGGAGGCCGAGGCAGG - Intronic
1083563497 11:63693370-63693392 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1083578279 11:63808442-63808464 CGAGGCAGGAGTGCCGAGGCAGG + Intergenic
1083696794 11:64448792-64448814 CTGGTTACGAGGGCAGGGGCAGG + Intergenic
1083877541 11:65532176-65532198 CACTTTGGGAGGGCCGAGGCAGG + Intronic
1084130595 11:67131076-67131098 CTACTTTGCAAGGCCGAGGCGGG + Intronic
1084134386 11:67165231-67165253 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1084159206 11:67335762-67335784 CTACTCGGGGGGGCCGAGGCAGG + Intronic
1084254410 11:67929866-67929888 CTACTCAGGAGGGCTGAGGTGGG + Intergenic
1084630782 11:70347755-70347777 CTACTTTGGGAGGCCGAGGCAGG + Intronic
1084818461 11:71666017-71666039 CTACTCAGGAGGGCTGAGGTGGG - Intergenic
1084944380 11:72630941-72630963 CTAGTCTGGAGGGCTGGGGCTGG + Intronic
1085801249 11:79591691-79591713 ATACTTTGGAAGGCCGAGGCAGG - Intergenic
1085952600 11:81350194-81350216 CTACTTCGGGAGGCCGAGGCGGG - Intergenic
1086164586 11:83762825-83762847 GCACTTTGGAGGGCCGAGGCAGG - Intronic
1086172370 11:83850928-83850950 CTACTTTGGGAGGCCGAGGCGGG + Intronic
1086666920 11:89493999-89494021 GCAGTTAGGGAGGCCGAGGCTGG - Intronic
1086684982 11:89722716-89722738 CTACTTTGGAAGGCCGAGGCGGG + Intergenic
1086755742 11:90559074-90559096 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1087014958 11:93545474-93545496 CTACTTGGGAGGCCTGAGGCAGG + Intergenic
1087285054 11:96256118-96256140 CTACTTTGGGAGGCCGAGGCGGG - Intronic
1087287173 11:96277503-96277525 CTCTTTGGGAGGGCCGAGGCAGG + Intronic
1087510186 11:99082427-99082449 GCACTTTGGAGGGCCGAGGCGGG - Intronic
1087559286 11:99764525-99764547 CTACTTGGGAAGGCGGAGGCAGG - Intronic
1087883319 11:103445896-103445918 GCAGTTTGGAAGGCCGAGGCGGG - Intronic
1088311539 11:108465871-108465893 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1088317233 11:108519837-108519859 CTACCTGGGAGGGCTGAGGCAGG + Intronic
1088348847 11:108861913-108861935 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1088581825 11:111324036-111324058 CTACTCGGGAGGGCTGAGGCAGG + Intergenic
1088767067 11:112992751-112992773 GCACTTAGGAAGGCCGAGGCTGG - Intronic
1088873789 11:113916081-113916103 CTACTTCGGAAGCCCGAGGCAGG - Intronic
1089465686 11:118684589-118684611 CTACTTTGGGGGGCTGAGGCTGG - Intergenic
1089475915 11:118761503-118761525 CTACTCGGGAGGGCTGAGGCAGG + Intronic
1089490869 11:118883215-118883237 CAACTTTGGAAGGCCGAGGCAGG - Intergenic
1089510310 11:118992474-118992496 AAAGTTATGAAGGCCGAGGCTGG - Intergenic
1089540559 11:119187026-119187048 CTACTCGGGAGGGCTGAGGCAGG + Intronic
1089550304 11:119270354-119270376 CTACTTGGGAGAGCTGAGGCAGG - Intronic
1089743424 11:120600584-120600606 CTAGCCAGGAGTGCAGAGGCAGG + Intronic
1090342609 11:126038403-126038425 GCACTTAGGGGGGCCGAGGCAGG + Intronic
1202816025 11_KI270721v1_random:46871-46893 CATGTTGGGAGGGCCGAGGAGGG + Intergenic
1091759008 12:3075340-3075362 GTACTTAGGGAGGCCGAGGCGGG - Intergenic
1091961172 12:4695623-4695645 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1092359079 12:7820973-7820995 CTACTTCGGAAGGCTGAGGCAGG + Intronic
1092371333 12:7918842-7918864 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1092466691 12:8739719-8739741 CCACTTTGGAAGGCCGAGGCAGG - Intronic
1092616057 12:10216649-10216671 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1093249999 12:16791143-16791165 CTAGTTAGGATGGCATAGACAGG + Intergenic
1093263385 12:16969365-16969387 GCACTTTGGAGGGCCGAGGCAGG - Intergenic
1093654742 12:21681641-21681663 CTACTTGGGAGGCCTGAGGCAGG + Intronic
1094007796 12:25773939-25773961 GTACTTTGGAAGGCCGAGGCGGG + Intergenic
1094055478 12:26265187-26265209 CTTGTTAGGAAGGCCTTGGCTGG - Intronic
1094245301 12:28284539-28284561 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1094542784 12:31376386-31376408 CTACTTTGGAAGGCCGAGCCGGG - Intergenic
1094679328 12:32653795-32653817 GTACTTCGGAAGGCCGAGGCAGG + Intergenic
1095129564 12:38523098-38523120 CTACTCAAGAGGGCTGAGGCAGG + Intergenic
1095420846 12:42022103-42022125 GTACTTTGGAAGGCCGAGGCTGG - Intergenic
1095897084 12:47290532-47290554 CTACTTTGGGGGGCTGAGGCAGG - Intergenic
1096272339 12:50175249-50175271 CTACTCAGGAGGTCTGAGGCAGG + Intergenic
1096391828 12:51235587-51235609 CAAGTTTGGGAGGCCGAGGCAGG + Intergenic
1096626285 12:52898051-52898073 CTACTTGGGAGGCCTGAGGCAGG + Intronic
1096640238 12:52988447-52988469 CTACTCCGGAGGGCTGAGGCAGG + Intergenic
1096663780 12:53148592-53148614 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1096737698 12:53668770-53668792 GCAGTTAGGGAGGCCGAGGCAGG + Intronic
1096742397 12:53703363-53703385 CTACTTAGGAGGCTTGAGGCAGG - Intergenic
1097111196 12:56659516-56659538 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1097120317 12:56726521-56726543 GTAGTTTGGGAGGCCGAGGCAGG - Intronic
1097256313 12:57677877-57677899 GCACTTTGGAGGGCCGAGGCAGG + Intergenic
1097306457 12:58074450-58074472 CTAGTTGGGACAGCCTAGGCAGG + Intergenic
1097766248 12:63530519-63530541 CACTTTAGGAGGGCCAAGGCAGG + Intergenic
1097767381 12:63541745-63541767 CTACTTAGGAGGCTTGAGGCGGG + Intergenic
1097782684 12:63726360-63726382 CACTTTGGGAGGGCCGAGGCAGG + Intergenic
1097783752 12:63736785-63736807 CTACTTAGGAGGCTTGAGGCGGG + Intergenic
1098414436 12:70216583-70216605 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1098431636 12:70425890-70425912 GTAGTTTGGGGGGCCGAGGCAGG + Intronic
1098681989 12:73367795-73367817 GTACTTTGGAAGGCCGAGGCGGG + Intergenic
1099094329 12:78354082-78354104 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1099121260 12:78691762-78691784 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1099211908 12:79801097-79801119 GTAGTTTGGGAGGCCGAGGCAGG + Intronic
1099979547 12:89582754-89582776 CTAGTCAGGGAGGCTGAGGCAGG + Intergenic
1100182266 12:92098453-92098475 CTACTCAGGGAGGCCGAGGCAGG + Intronic
1100265722 12:92974133-92974155 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1100508128 12:95241141-95241163 CTACTTGGGAGGCCTGAGGCAGG - Intronic
1100945300 12:99776789-99776811 CTAGCTTGGGGGGCTGAGGCAGG - Intronic
1101158405 12:101949717-101949739 GCAGTTTGGAAGGCCGAGGCAGG + Intronic
1101382785 12:104228963-104228985 CTACTTTGGGAGGCCGAGGCGGG - Intronic
1101454891 12:104820751-104820773 CTACTTCGGAAGGCTGAGGCAGG - Intronic
1101888337 12:108688917-108688939 CTACTCGGGAGGGCTGAGGCAGG + Intronic
1102126586 12:110487244-110487266 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1102333351 12:112055591-112055613 CTACTCAGGAGGGCTGAGGTTGG + Intronic
1102376281 12:112423996-112424018 GTACTTTGGAAGGCCGAGGCAGG - Intronic
1102900446 12:116632558-116632580 GTAGTTTGGGAGGCCGAGGCAGG - Intergenic
1103387465 12:120544274-120544296 ACAGTTTGGAAGGCCGAGGCAGG + Intronic
1103437608 12:120938741-120938763 GTACTTTGGAAGGCCGAGGCAGG + Intergenic
1103555594 12:121764407-121764429 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1103625905 12:122219608-122219630 ATAGTTTGGGAGGCCGAGGCGGG + Intronic
1103759899 12:123241447-123241469 CTACTTGGGAGGACTGAGGCAGG - Intronic
1104581882 12:130016776-130016798 GTAGTTTGGGAGGCCGAGGCGGG - Intergenic
1106286898 13:28325701-28325723 CTACTTGGGAGGGTAGAGGCAGG + Intronic
1107296648 13:38915977-38915999 CTACTTTGGGAGGCCGAGGCGGG - Intergenic
1107858610 13:44639636-44639658 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1107873812 13:44771360-44771382 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1108355630 13:49626565-49626587 CTCGGTTGGAAGGCCGAGGCGGG - Intergenic
1108399962 13:50030889-50030911 GCACTTTGGAGGGCCGAGGCGGG + Intergenic
1109304624 13:60624913-60624935 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1109690873 13:65886972-65886994 GCACTTTGGAGGGCCGAGGCGGG - Intergenic
1109853377 13:68098375-68098397 GTATTTTGGAGGGCCAAGGCGGG - Intergenic
1109901684 13:68780964-68780986 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1110258994 13:73464362-73464384 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1110352995 13:74531764-74531786 GTACTTTGGAAGGCCGAGGCAGG - Intergenic
1111033844 13:82644095-82644117 GGAGTTGGGAGGGCTGAGGCAGG - Intergenic
1111453244 13:88446812-88446834 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1112271443 13:97973954-97973976 CTAGTTGGAAGGGCTGAGGTGGG + Intronic
1112526390 13:100151478-100151500 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1113134444 13:107074045-107074067 CTAGTGAGGAGGGGGGAGACAGG + Intergenic
1113474392 13:110569944-110569966 GTACTTGGGAAGGCCGAGGCTGG + Intergenic
1114127723 14:19749485-19749507 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1114318885 14:21530397-21530419 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1114466352 14:22925571-22925593 ATACTTTGGAAGGCCGAGGCGGG + Intronic
1114508520 14:23237073-23237095 CTACTTAGGGAGGCTGAGGCAGG - Intronic
1115229731 14:31147063-31147085 CTACTTTGGGAGGCCGAGGCAGG + Intronic
1115322279 14:32095522-32095544 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1115483294 14:33883862-33883884 GTACTTTGGAAGGCCGAGGCAGG - Intergenic
1115574964 14:34702421-34702443 CTACTCAGGAAGGCCGAGGCAGG + Intergenic
1115576835 14:34719527-34719549 CTACTTGGGAGGGCTGAGGCAGG + Intergenic
1115599412 14:34941092-34941114 CCACTTTGGAAGGCCGAGGCAGG + Intergenic
1115618022 14:35114880-35114902 CTACTTAGGAGGGCTGAGGCAGG + Intronic
1115621358 14:35143757-35143779 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1115682625 14:35758625-35758647 CTACTTGGGAAGGCTGAGGCTGG + Intronic
1115988697 14:39129003-39129025 CTACTAGGGAGGGCTGAGGCAGG + Intronic
1116424469 14:44773256-44773278 CTACTTTGGGAGGCCGAGGCGGG + Intergenic
1116646972 14:47540673-47540695 CTAGCTTGGAAGGCTGAGGCAGG - Intronic
1117056660 14:51918934-51918956 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1117115805 14:52509867-52509889 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1117131937 14:52695613-52695635 AGAGGCAGGAGGGCCGAGGCGGG - Exonic
1117154569 14:52925445-52925467 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1117329051 14:54694694-54694716 CCAGTCAGGAGGTCTGAGGCTGG - Intronic
1117352004 14:54890384-54890406 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1117383222 14:55186157-55186179 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1117385223 14:55205313-55205335 CTACTCAGGAGGGCTGAGGTGGG - Intergenic
1117589265 14:57249881-57249903 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1117846348 14:59915479-59915501 CTACTCAGGAAGGCTGAGGCGGG - Intergenic
1118062084 14:62150579-62150601 CAAGTTTGGGAGGCCGAGGCGGG - Intergenic
1118133677 14:62997649-62997671 TTGGTTTGGAAGGCCGAGGCAGG + Intronic
1118180119 14:63483970-63483992 CTACTCAGGGGGGCTGAGGCAGG + Intronic
1118196844 14:63634756-63634778 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1118300160 14:64608105-64608127 ATAGTTTGGGAGGCCGAGGCGGG - Intergenic
1118597284 14:67445693-67445715 CTACTTAGGAGGACTGAGGTGGG - Intergenic
1118812114 14:69282775-69282797 CTACTCAGGAGGGATGAGGCAGG - Intronic
1118969254 14:70619245-70619267 CTATTTAAGAGGGCTGATGCAGG - Intergenic
1118977286 14:70688652-70688674 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1119303099 14:73586280-73586302 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1119375274 14:74186178-74186200 CTACTTGGGAAGGCTGAGGCGGG + Intronic
1119577451 14:75739051-75739073 CACTTTGGGAGGGCCGAGGCAGG - Intronic
1119578762 14:75755151-75755173 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1119807691 14:77492881-77492903 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1120237833 14:81913087-81913109 CTACTTGGGAGGGCTGAGGCAGG + Intergenic
1120592722 14:86394851-86394873 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1121367846 14:93331632-93331654 GTAGTTCGGAAGGACGAGGCGGG + Intronic
1122513631 14:102290326-102290348 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1124103717 15:26718318-26718340 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1124106417 15:26741854-26741876 AGAGTGAGGAGGGCCAAGGCAGG - Intronic
1124381360 15:29170059-29170081 GCACTTTGGAGGGCCGAGGCAGG + Intronic
1124616011 15:31242767-31242789 CTAATTGGGAGTGCTGAGGCAGG - Intergenic
1124838494 15:33219287-33219309 CTACTTGGGAGGCCTGAGGCAGG + Intergenic
1125592478 15:40863557-40863579 GCACTTTGGAGGGCCGAGGCTGG - Intergenic
1125640620 15:41227556-41227578 CTATTCAGGAAGGCTGAGGCAGG + Intronic
1125810678 15:42538502-42538524 CTATTGAGGAGGCCTGAGGCTGG - Exonic
1125812777 15:42556056-42556078 CTAGTTTGGGAGGCTGAGGCAGG - Intronic
1125907030 15:43402166-43402188 CTACTTGGGAGGCCTGAGGCAGG + Intronic
1126018504 15:44376120-44376142 CTACTTGGGACGGCTGAGGCAGG + Intronic
1126079691 15:44947566-44947588 CTACTCGGGAGGGCTGAGGCAGG + Intergenic
1126208495 15:46073399-46073421 CTAGTTAGGAGGCCTTAGGTAGG - Intergenic
1126397513 15:48234631-48234653 CTACTTGCGGGGGCCGAGGCAGG + Intronic
1126459040 15:48895834-48895856 CCACTTAGGGAGGCCGAGGCAGG + Intronic
1126584705 15:50272327-50272349 CTACTCAGGAGGCCTGAGGCAGG + Intergenic
1126620536 15:50635204-50635226 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1126641492 15:50831467-50831489 CTACTCAGGAAGGCTGAGGCGGG - Intergenic
1127086590 15:55429404-55429426 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1127418274 15:58779006-58779028 ATAGTTTGGAAGGCTGAGGCGGG - Intronic
1127438000 15:58977242-58977264 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1127704378 15:61532708-61532730 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1127801665 15:62482489-62482511 CTACTCAGGAGGGGGGAGGCAGG + Intronic
1127899214 15:63328945-63328967 ATAGTTTGGGAGGCCGAGGCAGG - Intronic
1128111721 15:65080392-65080414 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1128289273 15:66464634-66464656 CTACTCAGGATGGCTGAGGCAGG - Intronic
1128310118 15:66625308-66625330 CTAGTTGGGGAGGCTGAGGCAGG + Intronic
1128336756 15:66791495-66791517 CTACTCAGGAGGGTGGAGGCAGG + Intergenic
1128337309 15:66795417-66795439 CTACTCAGGAGGGTGGAGGCAGG - Intergenic
1128892594 15:71344287-71344309 GTACTTTGGGGGGCCGAGGCGGG - Intronic
1129232122 15:74202785-74202807 CCAGCTGGGAGGGCCCAGGCAGG - Exonic
1129533613 15:76291502-76291524 GTACTTTGGGGGGCCGAGGCGGG + Intronic
1129595560 15:76961223-76961245 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1129599543 15:76990402-76990424 GTAGTTAGCTGGGCCAAGGCAGG + Intergenic
1129652335 15:77499939-77499961 CTATTAGGGAGGGCTGAGGCAGG - Intergenic
1130222116 15:82028522-82028544 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1130271546 15:82452877-82452899 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1130332161 15:82930913-82930935 CTACTTGGGGGGGCTGAGGCAGG + Intronic
1130463887 15:84180216-84180238 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1130488788 15:84414570-84414592 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1130500379 15:84493325-84493347 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1130604141 15:85299635-85299657 GCAGTTAGGGAGGCCGAGGCAGG + Intergenic
1131243400 15:90768835-90768857 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1131379464 15:91951799-91951821 ATACTTAGGGAGGCCGAGGCAGG - Intronic
1131563000 15:93460492-93460514 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1132264814 15:100460639-100460661 CTAGTGAGGAGGGGAGAGCCAGG - Intronic
1132360161 15:101205838-101205860 CTACTCAGGGGGGCTGAGGCAGG + Intronic
1132512440 16:351018-351040 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1132780652 16:1623005-1623027 CTACTTTGGGAGGCCGAGGCAGG - Intronic
1132898669 16:2241405-2241427 CTACTTGGGAAGGCTGAGGCCGG - Intronic
1132906957 16:2287522-2287544 CTACTTTGGGAGGCCGAGGCAGG - Intronic
1133327433 16:4950396-4950418 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1133431103 16:5737372-5737394 CTACTTTGGAAGGCTGAGGCAGG + Intergenic
1133535925 16:6702305-6702327 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1133812097 16:9168496-9168518 CTACTCAGGAGGGATGAGGCAGG + Intergenic
1133981083 16:10633790-10633812 CCACTTTGGAAGGCCGAGGCAGG - Intronic
1134169657 16:11958314-11958336 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1134355335 16:13476990-13477012 CAAGTTTGGGAGGCCGAGGCGGG - Intergenic
1134458155 16:14409655-14409677 GTACTTTGGAAGGCCGAGGCAGG - Intergenic
1134481863 16:14626721-14626743 CTACTTAGGGAGGCTGAGGCAGG - Intronic
1134650288 16:15903224-15903246 CTCGTCAGGGGGGCCAAGGCAGG - Intergenic
1135250139 16:20894155-20894177 CTACTCAGGAGGGCTGAGACAGG + Intronic
1135291416 16:21242296-21242318 CTACTTGGGAGGGCTGAGGCAGG - Intronic
1135743497 16:24996837-24996859 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1136038048 16:27555586-27555608 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1136243332 16:28958201-28958223 GTAGTTTGGGAGGCCGAGGCAGG + Intronic
1136274027 16:29167482-29167504 CTACTCAGGAGGGCTGAGGTGGG + Intergenic
1136554624 16:31000734-31000756 CCAGTTTGGGAGGCCGAGGCGGG - Intronic
1137591255 16:49695402-49695424 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1137639965 16:50020205-50020227 CTACTCAGGGAGGCCGAGGCAGG + Intergenic
1138022011 16:53493273-53493295 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1138432604 16:56978589-56978611 CTACTCAGGAGGGCTGAGGTGGG - Intronic
1138632431 16:58309139-58309161 GCACTTTGGAGGGCCGAGGCAGG + Intronic
1138685309 16:58720088-58720110 CTACTCAGGAAGGCTGAGGCGGG + Intronic
1139038224 16:62973743-62973765 CTACTCAGGAGGCCTGAGGCAGG - Intergenic
1139219431 16:65165237-65165259 ATAGTTTGGGAGGCCGAGGCAGG + Intergenic
1139605596 16:68015987-68016009 CTGGATGGGAGGGCCCAGGCAGG - Intronic
1139693015 16:68653346-68653368 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1139797097 16:69492046-69492068 GTACTTTGGAAGGCCGAGGCAGG + Intergenic
1139931678 16:70532044-70532066 CAAGTTTGGGAGGCCGAGGCGGG + Intronic
1140324279 16:73986500-73986522 CTACTTTGGGAGGCCGAGGCAGG + Intergenic
1140416567 16:74777813-74777835 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1140763521 16:78133640-78133662 CTACTTTGGGAGGCCGAGGCGGG - Intronic
1141095985 16:81163555-81163577 AAAGTTAGGTGGGCCCAGGCTGG - Intergenic
1141334648 16:83142990-83143012 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1141361721 16:83401225-83401247 CTACTTTGGGGGGCTGAGGCAGG + Intronic
1141541031 16:84721637-84721659 TTACTTGGGAGGGCTGAGGCAGG - Intronic
1142515474 17:425206-425228 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1142615659 17:1133128-1133150 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1142674643 17:1506268-1506290 CACTTTGGGAGGGCCGAGGCAGG - Intronic
1142686810 17:1581915-1581937 CTACTCAGGAGGGCTGAGGCAGG - Intronic
1142704510 17:1686012-1686034 CACTTTGGGAGGGCCGAGGCAGG - Intergenic
1142846156 17:2678288-2678310 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1143083559 17:4399040-4399062 CTACTCGGGAGGGCTGAGGCAGG - Intergenic
1143144456 17:4765244-4765266 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1143658216 17:8309830-8309852 GCACTTAGGGGGGCCGAGGCAGG - Intergenic
1143870050 17:9951643-9951665 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1144436257 17:15245407-15245429 CTGGTTAGGACAGCCCAGGCAGG + Intronic
1144477704 17:15602993-15603015 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1144724786 17:17496443-17496465 CGAGCTGGGAGGGCCGGGGCGGG - Intergenic
1144920591 17:18760690-18760712 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1145737190 17:27241192-27241214 CTACTAAGGGGGGCTGAGGCAGG + Intergenic
1146112024 17:30098418-30098440 CTAGTCAGGAGAGCTGAGGTGGG + Intronic
1146140246 17:30361470-30361492 GCACTTTGGAGGGCCGAGGCGGG + Intergenic
1146329890 17:31918086-31918108 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1146417691 17:32651920-32651942 CCACTTTGGAAGGCCGAGGCGGG - Intronic
1146483109 17:33220819-33220841 GTACTTTGGGGGGCCGAGGCGGG + Intronic
1146657863 17:34645599-34645621 GTAGTGAGGAGGGCAGAGGCAGG - Intergenic
1146927863 17:36757436-36757458 CTAATTAGCAGGGATGAGGCTGG - Intergenic
1147013014 17:37466908-37466930 CTACTTTGGAAGGCCGAGGCGGG + Intronic
1147022525 17:37548569-37548591 CTACTTTGGGAGGCCGAGGCAGG + Intronic
1147053312 17:37814540-37814562 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1147136825 17:38438870-38438892 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1147171536 17:38622507-38622529 CTACTCAGGAGGGCTGAGGCAGG + Intergenic
1147226538 17:38982772-38982794 CTACTCCGGAGGGCTGAGGCAGG + Intergenic
1147332643 17:39707885-39707907 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1147616843 17:41834635-41834657 CTACTCAGTAGGGCTGAGGCAGG + Intronic
1147843937 17:43391861-43391883 CTACTTAGGCAGGCTGAGGCGGG + Intergenic
1147928402 17:43960430-43960452 CTACTCAGGTGGGCCGAGGCAGG + Intronic
1148057792 17:44811631-44811653 GTACTTTGGAAGGCCGAGGCAGG - Intronic
1148501786 17:48097140-48097162 CTACTTAGGAGGCCTGAGGCAGG + Intronic
1148546746 17:48524934-48524956 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1148697419 17:49569623-49569645 CTATTTTGGAAGGCCGAGGAAGG - Intergenic
1148710168 17:49674033-49674055 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1149509623 17:57229409-57229431 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1149675029 17:58452136-58452158 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1149762797 17:59247739-59247761 CTATTTGGGGGGGCTGAGGCAGG - Intronic
1149924075 17:60685336-60685358 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1150063934 17:62092651-62092673 CTACTCAGGGGGGCCGAGGCAGG + Intergenic
1150253600 17:63725118-63725140 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1150333718 17:64314852-64314874 CTACTTGGGGGGGCTGAGGCAGG - Intergenic
1150561374 17:66297879-66297901 CTACTCAGGAGGGCTGAGGCAGG - Intergenic
1150709888 17:67522055-67522077 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1150743413 17:67797685-67797707 CTATTCAGGAAGGCTGAGGCAGG - Intergenic
1150824813 17:68465176-68465198 GTACTTTGGAAGGCCGAGGCGGG - Intergenic
1150993394 17:70287053-70287075 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1151029130 17:70715262-70715284 CTATTTTGGGAGGCCGAGGCCGG + Intergenic
1151289463 17:73139025-73139047 CCACTTTGGGGGGCCGAGGCAGG + Intergenic
1151566816 17:74902993-74903015 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1151587875 17:75021956-75021978 CCAGGTAGGAGGGCTGAGACAGG + Intergenic
1151793352 17:76324487-76324509 CTACTTAGGGAGGCCGAGGCAGG + Intronic
1152093767 17:78261077-78261099 CCACTTTGGAAGGCCGAGGCAGG - Intergenic
1152114407 17:78376616-78376638 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1152385646 17:79972831-79972853 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1152699891 17:81813571-81813593 CTTGCTGGGAGGGCCGTGGCCGG - Exonic
1153019811 18:617481-617503 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1153023929 18:657165-657187 GTACTTTGGGGGGCCGAGGCGGG - Intronic
1153129612 18:1840205-1840227 GCAGTTTGGAAGGCCGAGGCGGG + Intergenic
1153901404 18:9620458-9620480 CCACTTTGGGGGGCCGAGGCAGG - Intergenic
1154257970 18:12801400-12801422 CTACATGGGAGGGCTGAGGCAGG + Intronic
1154298372 18:13171294-13171316 CTACTTTGGGGGGCCAAGGCGGG + Intergenic
1154962259 18:21321181-21321203 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1155050433 18:22142378-22142400 CTAATCAGGAAGGCTGAGGCAGG + Intergenic
1155131512 18:22939393-22939415 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1155157009 18:23166311-23166333 CTACTTGGGAGGGCTGAGGCAGG - Intronic
1155303330 18:24454074-24454096 CTACTCAGGGGGGCTGAGGCAGG + Intergenic
1156277583 18:35598279-35598301 ATACTTTGGAAGGCCGAGGCAGG - Intronic
1156872380 18:41960986-41961008 CTACTTTGGGAGGCCGAGGCAGG - Intronic
1157598979 18:48881639-48881661 ATAGTTTGGGAGGCCGAGGCGGG + Intergenic
1158249052 18:55466383-55466405 CTAATTGGAGGGGCCGAGGCAGG + Intronic
1158379823 18:56916815-56916837 CTGTTTGGGAGGCCCGAGGCAGG + Intronic
1158702973 18:59765803-59765825 GTACTTTGGAAGGCCGAGGCAGG + Intergenic
1159250975 18:65875815-65875837 CTACTTGGGAGTGCTGAGGCAGG + Intronic
1159589114 18:70312883-70312905 CTACTCAGGAGGGCTGAGGCAGG - Intronic
1159882240 18:73869028-73869050 CTACTCGGGAGGGCAGAGGCAGG + Intergenic
1160804567 19:986513-986535 CTACTCTGGGGGGCCGAGGCGGG - Intronic
1160880893 19:1319576-1319598 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1160997613 19:1890865-1890887 CCACTTTGGGGGGCCGAGGCCGG - Intergenic
1161196669 19:2990354-2990376 GCAGTTAGGGAGGCCGAGGCAGG + Intronic
1161297670 19:3527918-3527940 CCAGCTAGGAGGGCCATGGCAGG - Intronic
1161478011 19:4496983-4497005 CTACTCGGGAGGGCTGAGGCAGG - Intronic
1161808130 19:6456922-6456944 CCACTTTGGAAGGCCGAGGCAGG - Intronic
1161996134 19:7712774-7712796 CTACTTGGGAGGCCTGAGGCAGG - Intergenic
1162102144 19:8345617-8345639 CTATTTAGGGAGGCTGAGGCAGG - Intronic
1162116851 19:8435648-8435670 TTACTTGGGAGGGCCGAGGTGGG - Intronic
1162220309 19:9170880-9170902 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1162285022 19:9731848-9731870 CTACTCAGAAGGGCTGAGGCAGG - Intergenic
1162388559 19:10375668-10375690 GCACTTTGGAGGGCCGAGGCGGG + Intronic
1162690470 19:12425860-12425882 CTACTTGGGAGGCCTGAGGCAGG + Intronic
1162961015 19:14126851-14126873 CCAGTTTGGAAGGCTGAGGCGGG - Intronic
1163091777 19:15024975-15024997 GTACTTAGGGAGGCCGAGGCAGG + Intergenic
1163091799 19:15025111-15025133 CTACTTAGGAAGGCTGAGGCAGG + Intergenic
1163117239 19:15195930-15195952 CTAGTTAGGGGGGGCACGGCGGG + Intronic
1163383273 19:16982725-16982747 CTATCTAGGGGGGCTGAGGCAGG + Intronic
1163391778 19:17035600-17035622 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1163403531 19:17108822-17108844 CTACTCGGGAGGGCTGAGGCAGG - Intronic
1163510316 19:17731000-17731022 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1163553393 19:17978806-17978828 ATACTTTGGAAGGCCGAGGCAGG + Intronic
1163608013 19:18286345-18286367 CTATTTAGGGAGGCTGAGGCAGG - Intergenic
1163656002 19:18545299-18545321 CTAGTTTGGGAAGCCGAGGCAGG - Intergenic
1163717659 19:18881329-18881351 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1163925161 19:20334246-20334268 CTACTTGGGAGGCCTGAGGCAGG - Intergenic
1163948634 19:20563917-20563939 GCACTTTGGAGGGCCGAGGCAGG + Intronic
1164096270 19:22012488-22012510 CTACTTGGGAGCGCTGAGGCAGG - Intergenic
1164162765 19:22639597-22639619 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1164238388 19:23359467-23359489 CTACTTTGGGAGGCCGAGGCGGG - Exonic
1164950515 19:32332791-32332813 CTACTTAGTGGGGCTGAGGCAGG + Intergenic
1165000188 19:32754786-32754808 CTACTTGGGAAGGCTGAGGCTGG - Intronic
1165039946 19:33061912-33061934 GTAGTTTGGGAGGCCGAGGCAGG - Intronic
1165211327 19:34238146-34238168 CTAGCTATGATTGCCGAGGCAGG + Intergenic
1165407324 19:35638795-35638817 CTACTTGGGAGGGCTGAGGCAGG + Intergenic
1165505286 19:36223607-36223629 GCACTTTGGAGGGCCGAGGCGGG - Intronic
1165526313 19:36357987-36358009 GTACTTTGGAAGGCCGAGGCAGG - Intronic
1165567271 19:36741788-36741810 GCACTTTGGAGGGCCGAGGCGGG + Intronic
1165577780 19:36836510-36836532 GCAGTTTGGAAGGCCGAGGCGGG + Intronic
1165676919 19:37734223-37734245 CTACTCAGAAAGGCCGAGGCAGG - Intergenic
1165680913 19:37774385-37774407 CTAGTTTGGGAGGCCAAGGCGGG - Intronic
1165715493 19:38043091-38043113 GCAGTTTGGGGGGCCGAGGCGGG + Intronic
1165990148 19:39806374-39806396 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1166137710 19:40787286-40787308 GTACTTTGGAAGGCCGAGGCGGG + Intronic
1166150017 19:40865998-40866020 GTACTTTGGGGGGCCGAGGCAGG + Intronic
1166371551 19:42304167-42304189 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1166403611 19:42503031-42503053 CACTTTGGGAGGGCCGAGGCGGG + Intergenic
1166679143 19:44756765-44756787 CTAGTGAGGAGGGAGGGGGCTGG + Intronic
1166749390 19:45157660-45157682 GTAGTTTGGAAGGCTGAGGCAGG - Intronic
1166876105 19:45898432-45898454 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1167004150 19:46764747-46764769 CCAGGAAGGAGGGCCCAGGCTGG - Intronic
1167071192 19:47222852-47222874 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1167130121 19:47579646-47579668 ATACTTTGGAAGGCCGAGGCAGG - Intergenic
1167176266 19:47866565-47866587 CTACTTTGGGAGGCCGAGGCGGG - Intergenic
1167398148 19:49245263-49245285 CACTTTGGGAGGGCCGAGGCAGG - Intergenic
1167625882 19:50588854-50588876 CCACTTCGGAAGGCCGAGGCGGG + Intergenic
1167832607 19:52038399-52038421 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1167894812 19:52572163-52572185 CTACTCAGGAAGGCCGAGGCAGG - Intronic
1167904820 19:52650366-52650388 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1167935977 19:52908898-52908920 CTACTTTGGGAGGCCGAGGCAGG + Intergenic
1167957683 19:53080208-53080230 CTACTTAGGAAGGCTGAGGCAGG - Intronic
1167987617 19:53332332-53332354 CCACTTTGGAAGGCCGAGGCGGG - Intergenic
1168272943 19:55259761-55259783 CACTTTAGGAGGCCCGAGGCCGG + Intergenic
1168356295 19:55702205-55702227 CTACTTTGGGAGGCCGAGGCAGG - Intronic
1168356512 19:55703568-55703590 GTACTTTGGGGGGCCGAGGCAGG - Intronic
1168556100 19:57341361-57341383 GCACTTAGGAGGGCAGAGGCAGG - Intergenic
1168564832 19:57414277-57414299 CACCTTGGGAGGGCCGAGGCAGG - Intronic
1168608915 19:57783194-57783216 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1168651057 19:58092462-58092484 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1168720714 19:58553480-58553502 CTACTCAGCAGGGCTGAGGCAGG - Intronic
1202699368 1_KI270712v1_random:152131-152153 GCACTTTGGAGGGCCGAGGCAGG - Intergenic
925509965 2:4614692-4614714 CAACTTTGGAAGGCCGAGGCGGG + Intergenic
925779206 2:7365259-7365281 GTACTTTGGAAGGCCGAGGCAGG + Intergenic
926106396 2:10154805-10154827 CTACTTGGGAAGGCTGAGGCAGG - Intronic
926115990 2:10213822-10213844 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
926167383 2:10530013-10530035 CTACTTTGGAAGGCTGAGGCAGG - Intergenic
926190786 2:10725966-10725988 CTACCTAGGAAGGCTGAGGCAGG + Intronic
926253536 2:11170081-11170103 CTACTTTGGGAGGCCGAGGCGGG - Intronic
926305110 2:11632582-11632604 GCAGTTTGGGGGGCCGAGGCAGG - Intronic
926305302 2:11633764-11633786 CTAGTGAGGAGGGGTGGGGCTGG - Intronic
927351259 2:22119030-22119052 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
927592295 2:24366935-24366957 CTACTTAGGGAGGCTGAGGCAGG - Intergenic
927618057 2:24620491-24620513 CTACTTGGGAAGGCTGAGGCAGG + Intronic
927693343 2:25223558-25223580 GTAGTTTGGGAGGCCGAGGCGGG - Intergenic
927778695 2:25922230-25922252 CTACTTTGGAGAGCTGAGGCAGG - Intergenic
928014502 2:27642673-27642695 CTACTCAGGAAGGCTGAGGCAGG - Intronic
928019514 2:27691698-27691720 CTATTCAGGAGAGCTGAGGCAGG - Intronic
928212777 2:29335927-29335949 CTACTTGGGAGGGCTGAGGCAGG + Intronic
928326599 2:30324134-30324156 CTACTCTGGAGGGCTGAGGCAGG - Intergenic
928485306 2:31725005-31725027 CACCTTAGGAGGGCCGAGGTGGG + Intergenic
929443715 2:41986627-41986649 CTAGTTTGGAGGGTCGAAGCTGG + Intergenic
929758312 2:44786086-44786108 CTACTCGGGAGGGCTGAGGCAGG + Intergenic
929768740 2:44873568-44873590 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
930061377 2:47291978-47292000 ATACTTTGGAAGGCCGAGGCAGG + Intergenic
930077524 2:47419174-47419196 CTACTCAGGAAGGCTGAGGCAGG - Intronic
930108513 2:47658505-47658527 CCAGGTAGGAGGGTAGAGGCCGG - Intergenic
930376914 2:50579412-50579434 GTACTTCGGAAGGCCGAGGCAGG + Intronic
930599456 2:53426270-53426292 CCAGTTTGGGAGGCCGAGGCGGG + Intergenic
930642967 2:53873127-53873149 CTACTTGGGATGGCTGAGGCAGG + Intronic
930700769 2:54456519-54456541 GTAGGTAGGGGGCCCGAGGCAGG + Intronic
930825882 2:55696353-55696375 CTATTTGGGAGGGCTGAGGAAGG - Intergenic
931097943 2:58963161-58963183 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
931729393 2:65139582-65139604 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
932181334 2:69648995-69649017 CTACTCAGGAAGGCTGAGGCAGG - Intronic
932227621 2:70055190-70055212 CTACTCAGGAGGGCTGAGGCAGG + Intergenic
932355122 2:71061984-71062006 CTACTCAGGGGGGCTGAGGCAGG + Intergenic
932530942 2:72531871-72531893 CTACTCGGGAGGGCTGAGGCAGG + Intronic
932558454 2:72846118-72846140 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
932602792 2:73140760-73140782 GCACTTTGGAGGGCCGAGGCGGG - Intronic
932726388 2:74183204-74183226 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
932803837 2:74766320-74766342 CTACTTGGGAGGCCTGAGGCAGG + Intergenic
932933210 2:76067330-76067352 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
933508428 2:83208368-83208390 CTATTTTGGAAGGCTGAGGCAGG - Intergenic
933889793 2:86757060-86757082 CTACTCAGGAAGGCTGAGGCAGG + Intronic
934159051 2:89230813-89230835 CTAGTGAGGAAGGCAGATGCAGG - Intergenic
934687428 2:96332012-96332034 CTACTTGGGGGGGCTGAGGCAGG + Intergenic
935264402 2:101382169-101382191 CTGGATTGGAAGGCCGAGGCAGG + Intronic
936041144 2:109150328-109150350 CTGGAGAGGATGGCCGAGGCAGG + Intronic
937128855 2:119491755-119491777 GCACTTTGGAGGGCCGAGGCAGG - Intronic
937520772 2:122710717-122710739 GAAGTTTGGAAGGCCGAGGCGGG - Intergenic
937684627 2:124681806-124681828 GCAATTAGGAAGGCCGAGGCGGG - Intronic
938539795 2:132276390-132276412 CTACTTGGGAAGGCTGAGGCTGG + Intergenic
938965860 2:136387888-136387910 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
940145844 2:150542961-150542983 CTTCTTGGGATGGCCGAGGCTGG - Intergenic
940467980 2:154057273-154057295 CCACTTTGGGGGGCCGAGGCAGG - Intronic
940828841 2:158444669-158444691 CCACTCAGGAGGGCTGAGGCAGG + Intronic
940857388 2:158740069-158740091 CTACTTGGGGGGGCTGAGGCAGG + Intergenic
940924176 2:159345097-159345119 CTACTCAGGAAGGCTGAGGCAGG + Intronic
940936117 2:159496669-159496691 CTACTCAGGAAGGCTGAGGCAGG + Intronic
942036359 2:172014220-172014242 CTACTTGGGAAGGCTGAGGCAGG - Intronic
942326459 2:174780692-174780714 CAGGGTAGGAGGGCAGAGGCTGG + Intergenic
944069580 2:195654048-195654070 CTACTTGGGAAGGCTGAGGCAGG - Intronic
944206531 2:197163872-197163894 GCACTTTGGAGGGCCGAGGCGGG - Intronic
944232377 2:197409286-197409308 CTACTCAGGAAGGCTGAGGCAGG + Intronic
944408165 2:199409279-199409301 CTACTCAGGAAGGCTGAGGCAGG - Intronic
945259947 2:207834239-207834261 CTACTTGGGAAGGCTGAGGCAGG - Intronic
946005189 2:216519014-216519036 CTACTCAGGAGGGCTGAGGCAGG - Intronic
946448936 2:219763441-219763463 GCAGTTTGCAGGGCCGAGGCAGG - Intergenic
946455581 2:219823156-219823178 GTACTTTGGAAGGCCGAGGCAGG - Intergenic
946566276 2:220969238-220969260 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
947067858 2:226250628-226250650 ATAGTTTGGGAGGCCGAGGCTGG - Intergenic
947089526 2:226494735-226494757 CCACTTTGGAAGGCCGAGGCAGG + Intergenic
947194898 2:227552888-227552910 CTGTTCAGGAAGGCCGAGGCAGG + Intronic
947377299 2:229509701-229509723 CTACTTAGGAGGGCTGAAGCAGG + Intronic
947416703 2:229903922-229903944 CTACTCAGGAGGGCTGAGGCAGG + Intronic
947537602 2:230950479-230950501 CTCGTTATGAGGTCTGAGGCTGG - Intronic
947545293 2:231006253-231006275 GCAGTTTGGAAGGCCGAGGCAGG + Intronic
947589819 2:231379265-231379287 CTACTTAGGAGGCTTGAGGCAGG + Intergenic
947810645 2:233001766-233001788 CTACTTTGGGAGGCCGAGGCGGG + Intronic
948361095 2:237421073-237421095 CTACTCAGGAGGGCTGAGGCAGG + Intergenic
948367488 2:237466837-237466859 GTACTTTGGAAGGCCGAGGCGGG + Intergenic
949013524 2:241696143-241696165 CCACTTTGGAAGGCCGAGGCGGG + Intergenic
1168826827 20:819650-819672 TTAGTTTGGGAGGCCGAGGCAGG - Intergenic
1169161695 20:3384617-3384639 CTACTCAGGAGGGCTGAGGAGGG - Intronic
1169190093 20:3653261-3653283 CTGGGTAGGAGGGCCTAGGAGGG + Intergenic
1169428366 20:5513536-5513558 CCACTTAGGGAGGCCGAGGCAGG - Intergenic
1169452447 20:5723566-5723588 CACTTTGGGAGGGCCGAGGCAGG + Intergenic
1169910892 20:10646707-10646729 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1171178776 20:23075746-23075768 CTACTCAGGAGGGCTGAGGCAGG + Intergenic
1171388953 20:24788950-24788972 GTACTTTGGGGGGCCGAGGCAGG - Intergenic
1172069008 20:32242526-32242548 CTATTTGGGAAGGCTGAGGCAGG + Intergenic
1172234854 20:33364818-33364840 CCACTTTGGAAGGCCGAGGCGGG - Intronic
1172349039 20:34227384-34227406 GTACTTAGGGAGGCCGAGGCAGG + Intronic
1172548886 20:35783670-35783692 GTACTTTGGAAGGCCGAGGCAGG - Intronic
1172582610 20:36060186-36060208 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1172690669 20:36787467-36787489 CCACTTTGGAAGGCCGAGGCGGG - Intronic
1173468076 20:43300278-43300300 CTACTTTGGGAGGCCGAGGCAGG + Intergenic
1173512501 20:43641347-43641369 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1173611271 20:44370136-44370158 CTACTTGGGGGGGCTGAGGCGGG - Intronic
1173999756 20:47365829-47365851 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1174056535 20:47802218-47802240 CAAGTCAGCAGGGCAGAGGCAGG - Intergenic
1174226213 20:49002753-49002775 CTACTTGGGAGGGCTGAGGCAGG - Intronic
1174566291 20:51466823-51466845 GTAGTTTGGGAGGCCGAGGCGGG + Intronic
1174587448 20:51619755-51619777 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1174622345 20:51885413-51885435 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1174703293 20:52631021-52631043 CTAGTTAGGAGGACAGACTCTGG + Intergenic
1174906960 20:54561765-54561787 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1175091319 20:56506944-56506966 GTACTTTGGAAGGCCGAGGCGGG - Intronic
1175123227 20:56732815-56732837 GCACTTAGGAAGGCCGAGGCAGG - Intergenic
1175982265 20:62744613-62744635 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1176022620 20:62969903-62969925 CTACTTTGGGAGGCCGAGGCAGG - Intergenic
1176192183 20:63816991-63817013 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1176422200 21:6525292-6525314 GCACTTAGGAAGGCCGAGGCGGG - Intergenic
1176674150 21:9761536-9761558 CCACTTTGGAGGGCCAAGGCGGG + Intergenic
1176880410 21:14185629-14185651 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1176968613 21:15239870-15239892 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1177036226 21:16046422-16046444 CTACTCGGGAGGGCTGAGGCAGG + Intergenic
1177148762 21:17433447-17433469 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1177227973 21:18281984-18282006 CTACTTCGGGGGGCAGAGGCAGG + Intronic
1177661058 21:24084797-24084819 CTACTTAGGAAGGCTGAGGCAGG + Intergenic
1177743446 21:25181601-25181623 GCAGTTTGGAAGGCCGAGGCAGG + Intergenic
1177760195 21:25394446-25394468 CTACTTTGGGAGGCCGAGGCAGG - Intergenic
1178325779 21:31644356-31644378 GCACTTTGGAGGGCCGAGGCGGG + Intergenic
1178326689 21:31652103-31652125 GCAGTTTGGAAGGCCGAGGCAGG + Intergenic
1178572207 21:33749234-33749256 CTACTTTGGAAGGCCAAGGCAGG - Intronic
1178839702 21:36129010-36129032 CTACTCGGGAGGGCTGAGGCAGG - Intergenic
1178918223 21:36721549-36721571 CTACTTGGGAGGGCTGAGGCAGG - Intronic
1179195459 21:39158725-39158747 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1179208485 21:39305750-39305772 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1179276938 21:39900279-39900301 CCACTTTGGGGGGCCGAGGCGGG - Intronic
1179374108 21:40834160-40834182 CCAGTTTGGGAGGCCGAGGCGGG + Intronic
1179697691 21:43133608-43133630 GCACTTAGGAAGGCCGAGGCGGG - Intergenic
1179816099 21:43907274-43907296 CTACTTTGGGAGGCCGAGGCCGG - Intronic
1180285201 22:10739054-10739076 GTACTTTGGAAGGCCGAGGCGGG - Intergenic
1180557134 22:16587150-16587172 GTAGTTTGGAAGGCCAAGGCAGG - Intergenic
1180994478 22:19958778-19958800 CTACTTGGGGGGGCTGAGGCAGG + Intronic
1181040416 22:20189689-20189711 CTGGTTTGGGAGGCCGAGGCAGG + Intergenic
1181110302 22:20598793-20598815 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1181506029 22:23357881-23357903 GTAGTTCGGGAGGCCGAGGCAGG + Intergenic
1181576025 22:23795542-23795564 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1181653213 22:24272424-24272446 GTAGTTTGGGAGGCCGAGGCGGG + Intronic
1181693466 22:24580216-24580238 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1182199755 22:28556245-28556267 CTACTCAGGGGGGCTGAGGCAGG + Intronic
1182231672 22:28842001-28842023 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1182632863 22:31701097-31701119 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1182702859 22:32254556-32254578 GCACTTTGGAGGGCCGAGGCGGG + Intronic
1182767585 22:32769626-32769648 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1183154825 22:36066756-36066778 GTACTTAGGGAGGCCGAGGCGGG + Intergenic
1183250912 22:36729827-36729849 CTACTCAGGAGGGCTGAGGCAGG - Intergenic
1183445225 22:37849236-37849258 CCAGTTTGGGAGGCCGAGGCGGG - Exonic
1183835238 22:40447239-40447261 CTATTTGGGGGAGCCGAGGCAGG + Intronic
1183989258 22:41587156-41587178 CTACTCGGGAGGGCTGAGGCAGG + Intronic
1184015016 22:41779341-41779363 CAACTTGGGAAGGCCGAGGCGGG + Intronic
1184074325 22:42166495-42166517 CTACTCGGGAGGGCTGAGGCGGG + Intronic
1184809966 22:46824656-46824678 CCAGTTAGGAGGGTGGTGGCTGG + Intronic
1185386946 22:50537576-50537598 CTACTTAGGGAGGCTGAGGCAGG + Intergenic
949324346 3:2846883-2846905 CTACTCAGGAAGGCTGAGGCAGG + Intronic
949563485 3:5223971-5223993 GTACTTTGGAGGGCTGAGGCAGG - Intergenic
950057131 3:10034211-10034233 CTACTTGGGGGGGCTGAGGCAGG + Intronic
950065934 3:10111707-10111729 CTATTTGGGAAGGCTGAGGCAGG + Intergenic
950075726 3:10185444-10185466 CTACTCAGGAAGGCTGAGGCAGG + Intronic
950219621 3:11184667-11184689 ATAGTTTGGGAGGCCGAGGCGGG + Intronic
950439514 3:13001060-13001082 CTACTTGGGAGGCCTGAGGCAGG - Intronic
950634503 3:14305343-14305365 ACACTTAGGAAGGCCGAGGCGGG - Intergenic
951271100 3:20625397-20625419 GTACTTAGGGAGGCCGAGGCGGG + Intergenic
951475659 3:23102963-23102985 CCACTTTGGAAGGCCGAGGCGGG - Intergenic
952072174 3:29650537-29650559 GCACTTTGGAGGGCCGAGGCAGG - Intronic
952333835 3:32388055-32388077 ATATTTTGGAAGGCCGAGGCAGG - Intergenic
952353002 3:32558732-32558754 CTACTCAGGAAGGCTGAGGCAGG + Intronic
952370337 3:32716757-32716779 CTACTCAGGAAGGCTGAGGCAGG - Intronic
952374241 3:32752175-32752197 CTAGTCAAGAAGGCTGAGGCAGG + Intronic
952771773 3:37007918-37007940 CTACTCAGGAAGGCTGAGGCAGG + Intronic
953501412 3:43438496-43438518 CTATTTTGGAAGGCTGAGGCAGG + Intronic
953583309 3:44176705-44176727 CTAGGTTGGGAGGCCGAGGCAGG + Intergenic
953614128 3:44474883-44474905 GTACTTTGGACGGCCGAGGCAGG + Intronic
953737995 3:45512903-45512925 GTACTTTGGGGGGCCGAGGCAGG + Intronic
954040497 3:47883333-47883355 CTACTCAGGAAGGCTGAGGCAGG - Intronic
954467146 3:50662310-50662332 CTAATCAGGAGTCCCGAGGCAGG + Intergenic
954514848 3:51164510-51164532 CTACTTGGGAAGGCCGAGGCAGG + Intronic
954552251 3:51491731-51491753 CTACTCAGGGGGGCTGAGGCAGG + Intronic
954771491 3:52973863-52973885 CAAGATGGGAGGGCTGAGGCAGG - Intronic
955221799 3:57029182-57029204 CTACTTTGGGAGGCCGAGGCAGG + Intronic
955278918 3:57574958-57574980 CTACTCAGGAAGGCTGAGGCAGG - Intronic
955338439 3:58106400-58106422 CACTTTGGGAGGGCCGAGGCAGG - Intronic
955338577 3:58107275-58107297 CACTTTGGGAGGGCCGAGGCGGG - Intronic
955557117 3:60150105-60150127 CTACTCAGGAAGGCTGAGGCAGG - Intronic
955848806 3:63196904-63196926 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
956942068 3:74174817-74174839 CTACTCAGGGGGGCTGAGGCAGG - Intergenic
957068488 3:75546422-75546444 CTACTCAGGAGGGCTGAGGTGGG + Intergenic
957949020 3:87100191-87100213 GTACTTTGGAAGGCCGAGGCTGG + Intergenic
958731456 3:97964583-97964605 CTACTCAGGAGGTCCAAGGCAGG + Intronic
958736078 3:98010851-98010873 GTACTTTGGGGGGCCGAGGCGGG + Intronic
958788258 3:98622684-98622706 CTACTCAGGAGGCCTGAGGCAGG - Intergenic
959704826 3:109330188-109330210 CTACTCAGGAAGGCTGAGGCAGG + Intronic
959941943 3:112089415-112089437 CTACTCAGGAAGGCTGAGGCAGG + Intronic
960413022 3:117351156-117351178 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
961284926 3:125793847-125793869 CTACTCAGGAGGGCTGAGGTGGG - Intergenic
961315550 3:126032987-126033009 TAAGTTAGGAGGCCCAAGGCAGG - Intronic
961332438 3:126150664-126150686 CTATTCAGGAGGGCTGAGGCAGG - Intronic
961694879 3:128697839-128697861 GTACTTTGGAAGGCCGAGGCGGG - Intergenic
962016471 3:131445868-131445890 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
962729226 3:138264662-138264684 GCACTTTGGAGGGCCGAGGCGGG - Intronic
963807197 3:149735200-149735222 GCACTTAGGAAGGCCGAGGCAGG - Intronic
963810669 3:149773405-149773427 CGAGTTATGAGGATCGAGGCAGG - Intronic
964114656 3:153123238-153123260 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
964118150 3:153157489-153157511 CTACTTGGGGGGGCTGAGGCAGG - Intergenic
964142397 3:153419066-153419088 GTAGTTTGGGAGGCCGAGGCAGG - Intergenic
964438963 3:156684542-156684564 CTACTCAGGAAGGCTGAGGCAGG - Intronic
964549088 3:157866900-157866922 GTAATTTGGAGGGCCGAGGTGGG - Intergenic
964676539 3:159288624-159288646 CTACTCAGGAAGGCTGAGGCAGG + Intronic
964855103 3:161138256-161138278 CTACTCAGGAAGGCTGAGGCAGG - Intronic
965018855 3:163199202-163199224 CTACTCGGGAGGGCTGAGGCTGG + Intergenic
965143705 3:164870449-164870471 GTACTTTGGGGGGCCGAGGCGGG + Intergenic
965800067 3:172483338-172483360 GCACTTTGGAGGGCCGAGGCGGG + Intergenic
966023806 3:175250056-175250078 CTACTCAGGAAGGCTGAGGCAGG + Intronic
966400609 3:179543509-179543531 CTACTTAGGAAGGCTGAGGCAGG - Intergenic
966414381 3:179674002-179674024 CTACTCAGGAAGGCTGAGGCAGG - Intronic
966416956 3:179699111-179699133 GTACTTTGGAAGGCCGAGGCAGG - Intronic
966880773 3:184349312-184349334 CTACTCGGGAGGGCTGAGGCAGG + Intronic
967376074 3:188802670-188802692 CTACTCAGGGGGGCTGAGGCAGG + Intronic
967517727 3:190390288-190390310 ATACTTTGGAAGGCCGAGGCGGG + Intronic
967529121 3:190529290-190529312 CACTTTGGGAGGGCCGAGGCAGG + Intronic
968026597 3:195447712-195447734 CTACTTGGGAGGGCTGAGGCAGG + Intergenic
968082730 3:195857870-195857892 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
968504748 4:966627-966649 CTGGTCAGGAGGGCAGAGCCCGG + Intronic
968841090 4:3006266-3006288 CTACTCAGGAAGGCTGAGGCGGG + Intronic
969356075 4:6626714-6626736 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
969554305 4:7896105-7896127 CCAGTTTGGGAGGCCGAGGCGGG - Intronic
969741030 4:9026786-9026808 CTACTCAGGAGGGCTGAGGAGGG - Intergenic
969800367 4:9559666-9559688 CTACTCAGGAGGGCTGAGGTGGG - Intergenic
970385700 4:15554424-15554446 CTATTTTGGGAGGCCGAGGCAGG + Intronic
971073724 4:23124751-23124773 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
971334946 4:25713829-25713851 GCACTTAGGAAGGCCGAGGCAGG - Intergenic
971421129 4:26475110-26475132 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
971771772 4:30906774-30906796 GCAGTTAGGGAGGCCGAGGCAGG + Intronic
972271292 4:37512698-37512720 GCACTTAGGAAGGCCGAGGCGGG - Intronic
972503020 4:39695643-39695665 CCAGTTAGAAGGGTCCAGGCCGG - Intergenic
972506484 4:39724656-39724678 CTACTTGGGGGGGCTGAGGCAGG + Intronic
972511588 4:39772081-39772103 GCATTTAGGAAGGCCGAGGCAGG - Intronic
972537305 4:40010268-40010290 CTACTTCGGGAGGCCGAGGCGGG - Intergenic
972592860 4:40504537-40504559 GCACTTTGGAGGGCCGAGGCGGG - Intronic
972644541 4:40954895-40954917 GTACTTAGGGAGGCCGAGGCGGG - Intronic
972889606 4:43540314-43540336 CTACTTGGGGGGGCTGAGGCAGG + Intergenic
973320919 4:48809411-48809433 CTACTTAGGGAGGCTGAGGCAGG + Intronic
973566474 4:52193925-52193947 CCACTTTGGAAGGCCGAGGCAGG - Intergenic
973768109 4:54182121-54182143 CTACTCAGGAAGGCTGAGGCAGG - Intronic
974273380 4:59682056-59682078 GTAGTTAGCAGGGCCTGGGCAGG + Intergenic
974317368 4:60299409-60299431 CTACTTAGGAAGGCTGAGGCAGG - Intergenic
975142421 4:70931974-70931996 CTAGTTTGGAAGGCCGAAGTGGG - Intronic
975145041 4:70957687-70957709 CTACTTGGGAGGCCAGAGGCAGG - Intronic
975376910 4:73656966-73656988 GTAGTTCGGGAGGCCGAGGCAGG - Intergenic
975625598 4:76343566-76343588 ATAGTTTGGGAGGCCGAGGCAGG + Intronic
975646605 4:76552105-76552127 CAATTTAGGGGGGCCGAGGCGGG - Intronic
976176869 4:82363323-82363345 CTAATTTGGGAGGCCGAGGCAGG - Intronic
976217367 4:82727952-82727974 CACTTTGGGAGGGCCGAGGCGGG - Intronic
976391923 4:84514423-84514445 CTACTTTGGAAGGCTGAGGCAGG + Intergenic
976482573 4:85561948-85561970 CTAGTAAGGGAGGCCGAGGCGGG + Intronic
976614554 4:87063349-87063371 CTACTTGGGAAGGCTGAGGCAGG - Intronic
976657422 4:87503924-87503946 CTAGTTTGAGAGGCCGAGGCAGG - Intronic
976703182 4:87993376-87993398 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
976926020 4:90496864-90496886 CTACTCAGGAGTGCTGAGGCAGG + Intronic
977355672 4:95943114-95943136 CTACTTGGGAGGGCTGAGGCAGG - Intergenic
977957772 4:103049899-103049921 CTACTTGGGAGGCCTGAGGCAGG + Intronic
977958128 4:103053947-103053969 CTGGTTTGGGAGGCCGAGGCGGG - Intronic
978070685 4:104464315-104464337 CTAGTCTGGAGTGCAGAGGCAGG - Intergenic
978505747 4:109454290-109454312 GTACTTAGGGAGGCCGAGGCAGG + Intronic
978505887 4:109455359-109455381 CTACTCGGGAGGGCTGAGGCAGG - Intronic
978522825 4:109634369-109634391 CTACTCAGGAAGGCTGAGGCAGG + Intronic
978556700 4:109988727-109988749 CTGGGGAGGAGGGCAGAGGCAGG + Intronic
978659253 4:111104357-111104379 CGGGTTGGGGGGGCCGAGGCAGG - Intergenic
978791661 4:112669258-112669280 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
978876097 4:113641896-113641918 CTACTCAGGAAGGCTGAGGCAGG + Intronic
979552574 4:122007875-122007897 TTACTTAGGGAGGCCGAGGCGGG - Intergenic
979678093 4:123431498-123431520 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
980092179 4:128454527-128454549 CCAGTTAGGAGGGCGGAGGTGGG + Intergenic
981018524 4:140000914-140000936 CTACTTGGGAAGGCTGAGGCAGG + Intronic
981094824 4:140768025-140768047 CTAATTATGAGGGCTGAGGCGGG + Intergenic
981199075 4:141957313-141957335 CTACTTGGCAGGGCTGAGGCAGG - Intergenic
982171234 4:152663526-152663548 CTGGGTGTGAGGGCCGAGGCTGG + Intronic
982252063 4:153417175-153417197 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
982726330 4:158910383-158910405 CTACTCAGGAAGGCTGAGGCAGG - Intronic
983246897 4:165298067-165298089 GTAGTTTGGGAGGCCGAGGCGGG - Intronic
983283193 4:165706943-165706965 GCAGTTTGGGGGGCCGAGGCAGG + Intergenic
983538475 4:168882977-168882999 CTACTTGGGAGGGCTGAGGCAGG + Intronic
983853878 4:172617725-172617747 GTACTTAGGGAGGCCGAGGCGGG - Intronic
983946119 4:173587172-173587194 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
984408048 4:179358860-179358882 GTACTTTGGAAGGCCGAGGCCGG - Intergenic
984654608 4:182304456-182304478 TTACTTAGGGAGGCCGAGGCGGG - Intronic
985100206 4:186451051-186451073 CTACTTGGGAGGGCTGAGGCAGG + Intronic
986816655 5:11420076-11420098 CAAGTTTGGGAGGCCGAGGCGGG + Intronic
987339336 5:16925520-16925542 CTACTTGGGAAGGCTGAGGCAGG - Intronic
987524038 5:19024735-19024757 CTACTCAGGAGGGCTGAGGCAGG + Intergenic
988271607 5:29024625-29024647 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
988941186 5:36149793-36149815 CTACTCAGGAAGGCTGAGGCAGG + Intronic
989277836 5:39610447-39610469 CTACTTTGGGAGGCCGAGGCGGG - Intergenic
989373824 5:40738301-40738323 CTAGTCGGGAGTGCTGAGGCAGG + Intronic
989592611 5:43125667-43125689 CTACTCAGGAAGGCCGAGGCAGG + Intronic
989802771 5:45564480-45564502 CTACTTTGGGAGGCCGAGGCGGG - Intronic
990960951 5:61393149-61393171 CTACTCGGGAGGGCTGAGGCAGG - Intronic
990978465 5:61579792-61579814 CCAGTTGGGGGGGCTGAGGCAGG + Intergenic
991479387 5:67060721-67060743 CTACTTTGGGAGGCCGAGGCAGG - Intronic
991693488 5:69248497-69248519 CTACTTGGGAAGGCTGAGGCAGG - Intronic
991725938 5:69536003-69536025 CTACTTGGGAAGGCTGAGGCAGG + Intronic
992709305 5:79433312-79433334 CTCCTTTGGGGGGCCGAGGCAGG + Intronic
992797086 5:80263070-80263092 GTAGTTTGGGAGGCCGAGGCAGG - Intergenic
992862843 5:80929569-80929591 CTACTCAGGGGGGCTGAGGCAGG - Intergenic
993638762 5:90377377-90377399 CTACTCAGGAGGCCTGAGGCAGG + Intergenic
993667823 5:90722601-90722623 CTACTTGGGAAGGCTGAGGCAGG + Intronic
993978873 5:94516987-94517009 CTACTTAGGAGGCCTGAGGCAGG + Intronic
994301109 5:98148556-98148578 CCAGTTTGGAAGGCCAAGGCAGG - Intergenic
994510523 5:100697579-100697601 GTATTTTGGAAGGCCGAGGCAGG - Intergenic
994624869 5:102206308-102206330 CTACTTGGGGGGGCTGAGGCAGG - Intergenic
996054607 5:118969077-118969099 CTAGTGAGGAGGGATGAAGCAGG - Intronic
996462075 5:123756960-123756982 GAAGTTAGGAGGGCAGAGGTTGG + Intergenic
996838478 5:127820468-127820490 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
996893280 5:128448416-128448438 CTACTCAGGAAGGCTGAGGCAGG - Intronic
996893431 5:128451509-128451531 CTACTCAGGAGGCCTGAGGCAGG - Intronic
997118440 5:131150482-131150504 CACTTTGGGAGGGCCGAGGCGGG - Intergenic
997137646 5:131343599-131343621 CTACTCAGGAAGGCTGAGGCAGG + Intronic
997302824 5:132819025-132819047 GCAGTTTGGGGGGCCGAGGCGGG - Intergenic
997481274 5:134186422-134186444 CTACTTTGGGAGGCCGAGGCAGG + Intronic
997563201 5:134866571-134866593 CTACTCAGGGGGGCTGAGGCAGG + Intergenic
997572518 5:134942017-134942039 CTACTTGGGGGGGCTGAGGCAGG + Intronic
997957937 5:138294748-138294770 GCACTTTGGAGGGCCGAGGCGGG - Intronic
998226001 5:140326767-140326789 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
998472522 5:142394219-142394241 CTATTTGGGAAGGCTGAGGCAGG - Intergenic
998531588 5:142890022-142890044 CTACTTGGGAAGGCTGAGGCAGG + Intronic
999158126 5:149472990-149473012 CTACTTAGGGAGGCTGAGGCAGG + Intergenic
999696987 5:154196032-154196054 CTACTTGGGAAGGCTGAGGCAGG - Intronic
999996996 5:157101884-157101906 CTACTTGGCAGGGCTGAGGCAGG - Intronic
1000192455 5:158924604-158924626 GCAGTTTGGAAGGCCGAGGCGGG + Intronic
1000615840 5:163425678-163425700 GCAGTTTGGAAGGCCGAGGCAGG + Intergenic
1000657778 5:163902185-163902207 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1000789666 5:165590187-165590209 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1001006936 5:168060300-168060322 CTAATTTGGGGGGCTGAGGCAGG + Intronic
1001816672 5:174674954-174674976 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1001930018 5:175666178-175666200 CTAGGTAGCAGGGCAGAGACAGG - Intronic
1002208632 5:177582094-177582116 GCAGTTTGGAAGGCCGAGGCGGG - Intergenic
1002337751 5:178491979-178492001 GTACTTTGGGGGGCCGAGGCAGG - Intronic
1002693448 5:181067467-181067489 CTACTTAGGAGGCTGGAGGCAGG - Intergenic
1003026544 6:2559879-2559901 CTAATTGGGAGGGCGGAGGTGGG + Intergenic
1003511484 6:6784838-6784860 GCACTTTGGAGGGCCGAGGCAGG + Intergenic
1004153942 6:13150098-13150120 ACAGTTTGGAAGGCCGAGGCAGG + Intronic
1004600904 6:17149034-17149056 GGAGTTAGGGAGGCCGAGGCGGG + Intergenic
1004669138 6:17779381-17779403 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1004692004 6:18000315-18000337 CTACTTGGGAGGGCTGAGGCAGG + Intergenic
1005181515 6:23112765-23112787 CTACTCAGGAGGGCTGAGGCAGG - Intergenic
1005183840 6:23139627-23139649 CTACTCAGGAGGGCTGAGGCAGG - Intergenic
1005258851 6:24035056-24035078 CTACTTAGGAAGGCTGAAGCAGG - Intergenic
1005448242 6:25947552-25947574 CTACTTGGGAGGCCTGAGGCAGG + Intergenic
1006015454 6:31077288-31077310 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1006603055 6:35238480-35238502 CTAGTTAGGAGGACTGAAGCTGG + Intronic
1006836747 6:37003586-37003608 CTACTTTGGGAGGCCGAGGCAGG + Intergenic
1007014960 6:38456232-38456254 GTACTTAGGAAGGCTGAGGCAGG - Intronic
1007362730 6:41370411-41370433 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1007509461 6:42364203-42364225 CAAGTATGGAGGGCTGAGGCAGG - Intronic
1007864488 6:44953841-44953863 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1008514267 6:52304598-52304620 CTACTAGGGAGGGCTGAGGCAGG + Intergenic
1008536640 6:52511213-52511235 CTACTCAGGAGGACTGAGGCGGG - Intronic
1008728624 6:54452726-54452748 CTACTTGGGAGGCCTGAGGCAGG + Intergenic
1009400322 6:63247133-63247155 GAACTTTGGAGGGCCGAGGCGGG + Intergenic
1009922937 6:70085274-70085296 GTAGTTAGCAGGGCACAGGCTGG - Intronic
1010225033 6:73481062-73481084 CTACTAGGGAGGGCTGAGGCAGG - Exonic
1010233246 6:73553886-73553908 GTAGTTTGGGAGGCCGAGGCAGG + Intergenic
1010415255 6:75604383-75604405 GCATTTTGGAGGGCCGAGGCAGG + Intronic
1010768213 6:79800048-79800070 CTACTCAGGAGGGCTGAGGCAGG - Intergenic
1011016970 6:82767623-82767645 CGAGGAAAGAGGGCCGAGGCTGG - Intergenic
1011679342 6:89767928-89767950 CTACTCAGGAGGGCCTAGGTGGG + Intronic
1011812221 6:91146040-91146062 GTACTTTGGAAGGCCGAGGCGGG + Intergenic
1012307251 6:97674281-97674303 CTAGTTAGGGAGGCTAAGGCAGG + Intergenic
1012567317 6:100674742-100674764 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1012771401 6:103439459-103439481 ATACTTAGGAAGGCCGAAGCAGG + Intergenic
1013002401 6:106036923-106036945 CTACTTGGGAGTGCTGAGGCAGG - Intergenic
1013201370 6:107899606-107899628 CTACTTGGGAGGGCTGAGGCAGG + Intronic
1013369741 6:109458482-109458504 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1013469804 6:110452586-110452608 CTACTTGGGAGGGCTGAGGCAGG + Intronic
1013498647 6:110724241-110724263 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1014442592 6:121490537-121490559 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1014537158 6:122628146-122628168 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1014774023 6:125488066-125488088 GCACTTTGGAGGGCCGAGGCAGG + Intergenic
1014984013 6:127980062-127980084 GTACTTTGGGGGGCCGAGGCAGG + Intronic
1015016223 6:128416534-128416556 CTACTCGGGAGGGCTGAGGCAGG + Intronic
1015535633 6:134264752-134264774 CTACTTGGGAGGGCTGAGGTGGG - Intronic
1015550200 6:134403657-134403679 GCAGTTTGGGGGGCCGAGGCAGG - Intergenic
1017013509 6:150081382-150081404 GTAATTTGGAAGGCCGAGGCAGG - Intergenic
1017205720 6:151802878-151802900 CTACTTAGGGAGGCTGAGGCAGG + Intronic
1017476578 6:154800030-154800052 GTACTTTGGAAGGCCGAGGCGGG - Intronic
1017576785 6:155814456-155814478 CTACTAAGGAAGGCTGAGGCAGG - Intergenic
1018252625 6:161886583-161886605 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1018377077 6:163223145-163223167 GTACTTTGGGGGGCCGAGGCGGG + Intronic
1018796919 6:167193106-167193128 CTAGCTAGGGAGGCTGAGGCAGG + Intronic
1020199629 7:6069495-6069517 CCAGTTTGGGAGGCCGAGGCGGG + Intergenic
1020202630 7:6092287-6092309 CTACTCAGGAGGTCTGAGGCAGG - Intergenic
1020864138 7:13535419-13535441 GTAGTTTGGGAGGCCGAGGCAGG + Intergenic
1021387922 7:20054756-20054778 CCACTTTGGAAGGCCGAGGCGGG + Intergenic
1021577205 7:22115503-22115525 CTACTTAGGGGGGCTGAGGTGGG + Intergenic
1021700490 7:23314907-23314929 CTAGTTTGGGAGGCTGAGGCAGG - Intronic
1022460598 7:30602026-30602048 CTACTTTGGGAGGCCGAGGCGGG - Intronic
1022732594 7:33044137-33044159 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1022815904 7:33914071-33914093 CTACTCGGGAGGGCTGAGGCAGG - Intronic
1023406726 7:39841694-39841716 CATTTTGGGAGGGCCGAGGCAGG - Intergenic
1023935796 7:44739000-44739022 GCAGTTTGGAAGGCCGAGGCGGG - Intergenic
1023946295 7:44805616-44805638 CTACTTAGGAGGCTTGAGGCAGG + Intronic
1023947624 7:44815901-44815923 CTACTTAGGAGGCTGGAGGCAGG + Intronic
1023973372 7:45008471-45008493 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1024116320 7:46197235-46197257 GCACTTTGGAGGGCCGAGGCAGG - Intergenic
1024732422 7:52267922-52267944 CTACTCAGGGGGGCTGAGGCAGG - Intergenic
1024767316 7:52674890-52674912 CTACTTGGGAGGGTTGAGGCGGG + Intergenic
1025236459 7:57237942-57237964 CAAGTCAGCAGGGCAGAGGCAGG + Intergenic
1025613059 7:63095173-63095195 CTACTTTGGAAGGCTGAGGCAGG + Intergenic
1025753785 7:64314817-64314839 CACTTTAGGAGGCCCGAGGCGGG - Intronic
1025939401 7:66063059-66063081 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1025941209 7:66077180-66077202 CTACTTTGGGAGGCCGAGGCGGG + Intronic
1025942684 7:66085717-66085739 CTACTCAGGAGGGCTGAGGCAGG - Intronic
1026100087 7:67377648-67377670 GCAGTTTGGATGGCCGAGGCAGG + Intergenic
1026331911 7:69359521-69359543 CTACTTGGGAGGGCGGAGGTGGG + Intergenic
1026361478 7:69604772-69604794 CTAGTTAGGCAGGCCAAGCCTGG - Intronic
1026453819 7:70553876-70553898 CTACTTGGGAGGGTTGAGGCAGG - Intronic
1026715938 7:72789380-72789402 GTAGTTTGGGAGGCCGAGGCGGG - Intronic
1026921343 7:74157919-74157941 CTAGTTGGGAGGCTGGAGGCAGG - Intergenic
1027181699 7:75945168-75945190 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1027750569 7:82139894-82139916 CCAGCTAGGAAGGCTGAGGCAGG - Intronic
1027841084 7:83312563-83312585 CTCGGTTGGAAGGCCGAGGCGGG - Intergenic
1027844713 7:83357981-83358003 CTACTTTGGGAGGCCGAGGCGGG + Intergenic
1027926875 7:84476245-84476267 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1028115490 7:86992317-86992339 CTACTTGGGAGGGCTGAGGCAGG + Intronic
1028573078 7:92314049-92314071 CTACTTTGGTTGGCCGAGGCGGG + Intronic
1029051002 7:97687318-97687340 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1029214635 7:98938061-98938083 CTACTTAGGGAGGCTGAGGCAGG + Intronic
1029292197 7:99510688-99510710 GTACTTTGGGGGGCCGAGGCGGG - Intronic
1029529839 7:101117990-101118012 CTACTCAGGAGGGCTGAGGCAGG - Intergenic
1029660657 7:101958964-101958986 CTACTTAGGAGGGCTGAGGTGGG - Intronic
1029973563 7:104813000-104813022 CAAGTCAGGGGGGCTGAGGCAGG + Intronic
1029987858 7:104937998-104938020 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1029997295 7:105019858-105019880 CTACTTTGGGAGGCCGAGGCAGG + Intronic
1030018526 7:105248693-105248715 CACTTTAGGAGGCCCGAGGCAGG + Intronic
1030056887 7:105591026-105591048 GCAGTTTGGAAGGCCGAGGCAGG - Intronic
1030701710 7:112647654-112647676 CTACTTCGGGAGGCCGAGGCGGG - Intergenic
1031621513 7:123939329-123939351 CACTTTAGGAAGGCCGAGGCGGG - Intronic
1031881037 7:127198950-127198972 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1032143827 7:129360225-129360247 CTACTTGGGAAGGCTGAGGCAGG - Intronic
1032370085 7:131340387-131340409 CTACTTGGGGGGGCTGAGGCAGG - Intronic
1032413468 7:131717897-131717919 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1032678725 7:134159223-134159245 CTACTTAGGAGGGCTGAAGTGGG + Intronic
1033136072 7:138785521-138785543 GTACTTTGGAAGGCCGAGGCAGG - Intronic
1033438113 7:141352487-141352509 CTACTCAGGAGGGCTGAGGCAGG - Intronic
1033651142 7:143344996-143345018 CTACTTTGGAAGGCCGAGGCAGG - Intronic
1034059432 7:148072952-148072974 GTACTTTGGGGGGCCGAGGCGGG - Intronic
1034065536 7:148133213-148133235 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1034211075 7:149363664-149363686 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1034506127 7:151492948-151492970 CTACTCAGGAGGGCTGAGGCAGG - Intronic
1035128149 7:156626030-156626052 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1035186460 7:157129928-157129950 CTACTCAGGTGGGCTGAGGCAGG - Intergenic
1035723035 8:1806644-1806666 GTACTTTGGAAGGCCGAGGCTGG + Intergenic
1036159672 8:6375437-6375459 GAAGTTTGGAAGGCCGAGGCGGG - Intergenic
1036254571 8:7195051-7195073 CTATTCAGGAGGGCTGAGGTGGG + Intergenic
1036287678 8:7459085-7459107 CTACTTAGGAAGGCTGAGGCAGG + Intronic
1036333799 8:7852442-7852464 CTACTTAGGAAGGCTGAGGCAGG - Intronic
1036362922 8:8092437-8092459 CTATTCAGGAGGGCTGAGGTGGG - Intergenic
1036494443 8:9257292-9257314 CTACTTCTGGGGGCCGAGGCCGG - Intergenic
1036515471 8:9439668-9439690 CTGCTCAGGAGGGCTGAGGCAGG + Intergenic
1036524048 8:9518794-9518816 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1036651692 8:10648276-10648298 GTACTTTGGGGGGCCGAGGCAGG - Intronic
1036660322 8:10703754-10703776 GCAGTTAGGGAGGCCGAGGCGGG + Intronic
1036698232 8:10993399-10993421 CTGGTGAGGAGGGAGGAGGCGGG + Intronic
1036812562 8:11877533-11877555 CTAGTCAGGGAGGCTGAGGCAGG + Intergenic
1036822924 8:11954428-11954450 GTACTTAGGGAGGCCGAGGCGGG - Intergenic
1036895639 8:12632745-12632767 CTACTCAGGAGGGCTGAGGTGGG + Intergenic
1037089534 8:14896890-14896912 CTACTCAGGAGGGCTGAGGCGGG - Intronic
1037839663 8:22234849-22234871 CTACTTTGGAAGGCCAAGGCGGG - Intergenic
1037860817 8:22404313-22404335 CTACTTGGGAGGCCTGAGGCAGG + Intronic
1037976443 8:23217325-23217347 CTACTGGGGAGGGCTGAGGCAGG - Intronic
1038012282 8:23484731-23484753 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1038272891 8:26090370-26090392 CTACTCAGGGGGGCTGAGGCAGG + Intergenic
1038597053 8:28897094-28897116 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1038728476 8:30103628-30103650 CTAGTCACGGGGGCTGAGGCAGG + Intronic
1038776378 8:30534772-30534794 CTACTTTGGGAGGCCGAGGCGGG + Intronic
1039584322 8:38693222-38693244 CTACTTTGGGAGGCCGAGGCAGG + Intergenic
1039838082 8:41273378-41273400 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1039994771 8:42522432-42522454 CCACTTTGGGGGGCCGAGGCGGG + Intronic
1040545504 8:48395675-48395697 CTACTCAGGAGGTCTGAGGCAGG + Intergenic
1041146063 8:54877238-54877260 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1041493089 8:58456075-58456097 GCAGTTTGGGGGGCCGAGGCAGG + Intergenic
1041519448 8:58739441-58739463 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1041779484 8:61561675-61561697 CTATTTGGGAGGCCTGAGGCAGG + Intronic
1041879213 8:62728551-62728573 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1041937982 8:63356077-63356099 CTATTTGAGAGGGCTGAGGCAGG - Intergenic
1042131981 8:65596173-65596195 CTACTCAGGAGGGCTGAGGCAGG + Intergenic
1042951564 8:74205517-74205539 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1043013135 8:74905254-74905276 CTATTTTGGGAGGCCGAGGCGGG - Intergenic
1043741845 8:83824150-83824172 CACTTTGGGAGGGCCGAGGCAGG + Intergenic
1043980768 8:86636459-86636481 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1044017548 8:87062624-87062646 CTACTTAGGAAGGCTGAGGCAGG + Intronic
1044242523 8:89902955-89902977 CCAGGCAGGACGGCCGAGGCGGG - Intronic
1045130292 8:99144243-99144265 GTAGTTAGGGAGGCCAAGGCAGG + Intronic
1045142135 8:99298375-99298397 CTACTTAGGAAGGCTGAGGCAGG + Intronic
1045462460 8:102437849-102437871 GCAGTTTGGAAGGCCGAGGCAGG - Intergenic
1045487924 8:102647288-102647310 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1046695739 8:117337397-117337419 CTACTTGGGGGGGCTGAGGCAGG - Intergenic
1047111046 8:121789975-121789997 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1047419647 8:124696604-124696626 GTACTTTGGAAGGCCGAGGCAGG + Intronic
1047484663 8:125318289-125318311 CTACTTAGTAGGGCTGAGGTGGG + Intronic
1047720109 8:127631257-127631279 GCAGTTTGGAAGGCCGAGGCGGG + Intergenic
1047823709 8:128550281-128550303 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1049087943 8:140492708-140492730 CTAGTTGGGGTGGCTGAGGCAGG - Intergenic
1049114809 8:140676825-140676847 CTACTTGGGAGGCCTGAGGCGGG + Intronic
1049878431 8:145043829-145043851 CTACTTGGGAGGCCTGAGGCAGG - Intergenic
1049986962 9:960738-960760 CTAGGCAGGAGGGCTGAGGGAGG - Intronic
1050543304 9:6688344-6688366 CTACTTGGGGGGGCCGAGGCAGG + Intergenic
1050554866 9:6780654-6780676 CTACTTGGGAAGGCCGAGGCAGG + Intronic
1050664557 9:7920843-7920865 GTACTTTGGGGGGCCGAGGCAGG + Intergenic
1051059626 9:13031065-13031087 GCACTTTGGAGGGCCGAGGCGGG + Intergenic
1051260360 9:15257946-15257968 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1051722795 9:20055775-20055797 CTACTTAGGGAGGCTGAGGCAGG + Intergenic
1051877361 9:21806465-21806487 CTGGTTAGGGGGCCAGAGGCTGG + Intronic
1052298937 9:26931793-26931815 CCACTTTGGAAGGCCGAGGCAGG + Intronic
1052366800 9:27620994-27621016 CCACTTTGGAAGGCCGAGGCGGG + Intergenic
1052811681 9:33066441-33066463 GTACTTAGGAAGGCAGAGGCAGG + Intronic
1052812638 9:33075128-33075150 CCACTTTGGAAGGCCGAGGCGGG + Intronic
1053026510 9:34733747-34733769 GCAATTTGGAGGGCCGAGGCAGG - Intergenic
1053032436 9:34792557-34792579 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1053078244 9:35153197-35153219 GTACTTTGGAAGGCCGAGGCAGG + Intergenic
1053370135 9:37553802-37553824 CTACTTAGGGAGGCTGAGGCAGG + Intronic
1053492724 9:38522491-38522513 GTACTTTGGAAGGCCGAGGCAGG + Intergenic
1053754119 9:41285902-41285924 GTAGTTTGGGAGGCCGAGGCAGG - Intergenic
1054259638 9:62850257-62850279 GTAGTTTGGGAGGCCGAGGCAGG - Intergenic
1054332133 9:63769770-63769792 GTAGTTTGGGAGGCCGAGGCAGG + Intergenic
1055068449 9:72142878-72142900 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1055608762 9:77998978-77999000 CTACTTCGGGGGGCTGAGGCAGG + Intronic
1055610335 9:78016568-78016590 CTACTCGGGAGGGCTGAGGCAGG + Intronic
1056024180 9:82475390-82475412 CTACTCAGGGGGGCTGAGGCAGG + Intergenic
1056434403 9:86561554-86561576 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1056676936 9:88683747-88683769 GTAGTTTGGGAGGCCGAGGCGGG + Intergenic
1057248424 9:93479342-93479364 CTACTTTGGGAGGCCGAGGCGGG - Intronic
1057371132 9:94474260-94474282 GTACTTTGGAAGGCCGAGGCGGG - Intergenic
1057494661 9:95551845-95551867 GTAGTTTGGGAGGCCGAGGCGGG + Intergenic
1057690372 9:97278284-97278306 GTACTTTGGGGGGCCGAGGCGGG + Intergenic
1057762384 9:97887400-97887422 CTATTTTGGGGGGCTGAGGCAGG - Intergenic
1058334904 9:103814233-103814255 GTACTTTGGAAGGCCGAGGCAGG - Intergenic
1058668805 9:107343473-107343495 CTACTCAGGAAGGCAGAGGCAGG - Intergenic
1058791447 9:108449835-108449857 GCAGTTTGGAAGGCCGAGGCGGG + Intergenic
1058821900 9:108739952-108739974 CTACTAGGGAGGGCTGAGGCAGG - Intergenic
1058945808 9:109855012-109855034 GTACTTTGGGGGGCCGAGGCGGG - Intronic
1059214064 9:112543682-112543704 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1059878913 9:118668078-118668100 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1060272410 9:122155188-122155210 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1060438417 9:123616174-123616196 GTACTTTGGAAGGCCGAGGCAGG - Intronic
1060471254 9:123950418-123950440 GTACTTTGGAGGGCTGAGGCAGG + Intergenic
1060473296 9:123966594-123966616 CTACTCCGGAGGGCTGAGGCAGG - Intergenic
1060634039 9:125185871-125185893 CTACTCAGGAAGGCTGAGGCAGG + Intronic
1060997074 9:127880532-127880554 CTACTCAGGAAGGCTGAGGCAGG - Intergenic
1061308893 9:129749536-129749558 CTTGGCAGGAGGGCTGAGGCAGG + Intronic
1061376848 9:130231238-130231260 CTACTTAGGGGTGCTGAGGCAGG + Intronic
1061560467 9:131399163-131399185 CTACTCAGGAGGGGTGAGGCTGG + Intronic
1062415109 9:136444765-136444787 CTACTCAGGAAGGCCGAGACAGG + Intronic
1062422373 9:136489118-136489140 CTACTTGGGGGGGCTGAGGCAGG - Intergenic
1185555813 X:1020289-1020311 CACTTTGGGAGGGCCGAGGCAGG + Intergenic
1185711877 X:2310812-2310834 ATAGTTTGGGAGGCCGAGGCGGG + Intronic
1185743309 X:2551418-2551440 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1186470759 X:9820474-9820496 CTACTTGGGAGGGCTGAGGTGGG - Intronic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1186542097 X:10411295-10411317 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1187476558 X:19616206-19616228 GCACTTTGGAGGGCCGAGGCGGG - Intronic
1187548141 X:20273380-20273402 GCAGTTAGGGAGGCCGAGGCGGG + Intergenic
1187866403 X:23727064-23727086 GTAGTTTGGGAGGCCGAGGCGGG - Intronic
1187891318 X:23937534-23937556 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1187912853 X:24126832-24126854 GTAGTTTGGGAGGCCGAGGCGGG - Intergenic
1188471709 X:30548010-30548032 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1189792247 X:44615004-44615026 CTACTCAGGAAGGCGGAGGCAGG + Intergenic
1190163177 X:48048791-48048813 CTACTCAGGAGGGCTGAGGCAGG + Intronic
1190195984 X:48318935-48318957 CTACTTTGGAAGGCAGAGGCGGG - Intergenic
1190289993 X:48986128-48986150 CTATTTGGGAGGGCTGAGGCAGG + Intronic
1190373245 X:49763492-49763514 CTACGCAGGAGGGCTGAGGCAGG - Intergenic
1190747561 X:53333814-53333836 CTACTTAGGGGGGCTGAGGTGGG - Intergenic
1190839777 X:54133226-54133248 CTACTCAGGAGGGCTGAGGCCGG + Intronic
1190874184 X:54448295-54448317 CTACTTGGGAGGGCTGAGGCAGG - Intronic
1191725715 X:64278716-64278738 GTACTTTGGAAGGCCGAGGCGGG - Intronic
1192121295 X:68458697-68458719 CTACCTGGGAGGGCTGAGGCAGG - Intergenic
1192449064 X:71231709-71231731 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1192467452 X:71367183-71367205 CTCGGAACGAGGGCCGAGGCAGG - Intronic
1192535128 X:71920913-71920935 CTACTTAGGAAGGCTGAGGCAGG - Intergenic
1193111493 X:77734862-77734884 GTAATTTGGGGGGCCGAGGCAGG + Intronic
1193716640 X:84941673-84941695 TTACTCAGGGGGGCCGAGGCAGG + Intergenic
1193803096 X:85961173-85961195 GTACTTTGGAGGGCCAAGGCAGG + Intronic
1193851491 X:86542962-86542984 CTAGTCTGGAGGGCCAAGGGGGG + Intronic
1194260444 X:91687864-91687886 CTACTTGGGAGGCCTGAGGCAGG - Intergenic
1194525569 X:94973107-94973129 CTACTAGGGAGGGCTGAGGCAGG - Intergenic
1194656913 X:96584439-96584461 CTACTTGGGAAGGCTGAGGCAGG + Intergenic
1195044375 X:101043018-101043040 GCAGTTAGGGAGGCCGAGGCAGG + Intronic
1195324074 X:103743932-103743954 CCAGTTTGGGAGGCCGAGGCAGG - Intergenic
1195805544 X:108761489-108761511 CTAATTGGGAGGGCTGAGGCAGG - Intergenic
1196280157 X:113814718-113814740 GCACTTAGGAAGGCCGAGGCAGG + Intergenic
1196292206 X:113955864-113955886 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1196731384 X:118944454-118944476 GCAGTTTGGAAGGCCGAGGCAGG - Intergenic
1197229076 X:123984088-123984110 CTACTCAGGAAGGCTGAGGCAGG - Intronic
1197270225 X:124417319-124417341 CTACTTGGGAGGCCTGAGGCAGG - Intronic
1197775483 X:130116215-130116237 TGAGGTAGGAGGGCTGAGGCAGG - Intergenic
1197816218 X:130501288-130501310 CTACTTTGGGAGGCCGAGGCAGG - Intergenic
1198023370 X:132680886-132680908 CTACTTGGGAAGGCTGAGGCAGG + Intronic
1198557051 X:137806474-137806496 CTACTTGGGAAGGCTGAGGCAGG - Intergenic
1199104981 X:143855507-143855529 CCACTTGGGAAGGCCGAGGCGGG + Intergenic
1199636701 X:149820156-149820178 CTACTCAGGAAGGCTGAGGCAGG + Intergenic
1199881005 X:151974381-151974403 ACAGTGAGGCGGGCCGAGGCCGG + Intronic
1199933958 X:152553112-152553134 CTAGTTGGGAGGGCAGGGGGTGG + Intergenic
1200466246 Y:3523953-3523975 GTACTTTGGAAGGCCGAGGCGGG + Intergenic
1201702043 Y:16894142-16894164 CTATTTAGGAAGGTTGAGGCAGG + Intergenic
1202332379 Y:23768463-23768485 CTACTCAGGAGGGCGGAGGCAGG - Intergenic
1202538390 Y:25901600-25901622 CTACTCAGGAGGGCGGAGGCAGG + Intergenic