ID: 903970626

View in Genome Browser
Species Human (GRCh38)
Location 1:27116636-27116658
Sequence GTGGACAGTACAAAGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903970626_903970633 6 Left 903970626 1:27116636-27116658 CCCCCAGTCTTTGTACTGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 903970633 1:27116665-27116687 ACATCCAGTGTGTAGCTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 124
903970626_903970632 2 Left 903970626 1:27116636-27116658 CCCCCAGTCTTTGTACTGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 903970632 1:27116661-27116683 GTCAACATCCAGTGTGTAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 81
903970626_903970636 15 Left 903970626 1:27116636-27116658 CCCCCAGTCTTTGTACTGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 903970636 1:27116674-27116696 GTGTAGCTGGCTGGTCCACTGGG 0: 1
1: 0
2: 0
3: 10
4: 206
903970626_903970638 20 Left 903970626 1:27116636-27116658 CCCCCAGTCTTTGTACTGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 903970638 1:27116679-27116701 GCTGGCTGGTCCACTGGGAAGGG 0: 1
1: 1
2: 2
3: 33
4: 203
903970626_903970635 14 Left 903970626 1:27116636-27116658 CCCCCAGTCTTTGTACTGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 903970635 1:27116673-27116695 TGTGTAGCTGGCTGGTCCACTGG 0: 1
1: 0
2: 0
3: 13
4: 110
903970626_903970637 19 Left 903970626 1:27116636-27116658 CCCCCAGTCTTTGTACTGTCCAC 0: 1
1: 0
2: 0
3: 9
4: 161
Right 903970637 1:27116678-27116700 AGCTGGCTGGTCCACTGGGAAGG 0: 1
1: 1
2: 3
3: 29
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903970626 Original CRISPR GTGGACAGTACAAAGACTGG GGG (reversed) Intronic
901504674 1:9676975-9676997 GTGACCAGGACAATGACTGGTGG + Intronic
903970626 1:27116636-27116658 GTGGACAGTACAAAGACTGGGGG - Intronic
904771610 1:32884378-32884400 GGAGACAGAACACAGACTGGGGG + Intergenic
908640571 1:66218413-66218435 TTGGAAAGTACAAAGAAGGGAGG + Intronic
908842779 1:68295674-68295696 GTGGGCAGGCCATAGACTGGCGG - Intergenic
909476205 1:76083469-76083491 GTGGGCAGTAAGAAGACTGTGGG + Intronic
910224246 1:84920086-84920108 GGGGACAGTAAAAAGACCAGTGG + Intergenic
913462865 1:119106497-119106519 GGGGACAGTAAAAAGCCTAGTGG - Intronic
922714685 1:227861160-227861182 ATGGACACTACAAAAACTGAAGG + Intergenic
924786442 1:247204242-247204264 GTGGTCAGCACAAAGAAGGGAGG - Intergenic
1062815123 10:493709-493731 GTGGACAGGAGAAAGGATGGAGG + Intronic
1063807435 10:9661648-9661670 ATAGACAGTAAAAAGATTGGAGG - Intergenic
1064367894 10:14724747-14724769 GAGGACAGGAAAAAGACTGAAGG + Intronic
1066220160 10:33329786-33329808 GTGGACAAGACAGAGACAGGGGG + Intronic
1066437750 10:35409502-35409524 GTGAACAGAAAAAAGACTGGAGG + Intronic
1066478545 10:35772468-35772490 GAGGACAGTAAAAAGAGTAGTGG - Intergenic
1066683283 10:37956528-37956550 GTGGAGAGAACAAAAATTGGAGG + Intronic
1071406424 10:85338014-85338036 AGGCACAGTACAAAGTCTGGAGG + Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1079433568 11:20421595-20421617 GAGGACAGTTCAAATTCTGGTGG - Intronic
1084239167 11:67806507-67806529 GGTGACAGTCCAAAGGCTGGGGG - Intergenic
1084854892 11:71976962-71976984 GTGGACAGCACAAAGCTTGTGGG - Intronic
1092409852 12:8244136-8244158 GGTGACAGTCCAAAGGCTGGGGG - Intergenic
1094089309 12:26630302-26630324 GTGGAAAGTAGAAAGAAAGGAGG + Intronic
1098864414 12:75745715-75745737 GTGGAGAGGAGAAAGGCTGGTGG + Intergenic
1104687009 12:130793106-130793128 CTGGACAGTTCCAAGACTGCCGG + Intronic
1106136695 13:26978878-26978900 GTGCACAGGAAAAAGACTCGGGG + Intergenic
1106584291 13:31043874-31043896 TTGGACTGGACAAAGACAGGAGG + Intergenic
1109277513 13:60319249-60319271 GTGGACAGCACCAAGCCAGGAGG + Intergenic
1109596492 13:64562223-64562245 GGAGACAGTAAAAAGATTGGTGG - Intergenic
1111444763 13:88332984-88333006 ATCCACAGCACAAAGACTGGTGG + Intergenic
1112700040 13:101997114-101997136 GTGTATAGTATCAAGACTGGTGG - Intronic
1114226374 14:20742358-20742380 CTGTTGAGTACAAAGACTGGAGG - Intronic
1117478718 14:56121503-56121525 GTGGACACAACAAAGAGTTGTGG - Intronic
1117611189 14:57485012-57485034 GTCCACAGTACAATGAATGGAGG + Intronic
1117613228 14:57505267-57505289 GTGGCCAGCACAAAGACATGGGG + Intergenic
1118058549 14:62109213-62109235 GGGGACAGTACAAGGACCAGTGG - Exonic
1122112947 14:99514554-99514576 GGGGACATTGCAGAGACTGGGGG + Exonic
1124791707 15:32733204-32733226 GTGGACAATACAAAGATTTGGGG - Exonic
1125492986 15:40162201-40162223 GAGGAGAGTACAAAGGCTGAGGG + Intronic
1126408365 15:48346202-48346224 GAAGACAGTACAAAGACCAGTGG - Intergenic
1126446542 15:48752309-48752331 ATGGATGCTACAAAGACTGGTGG + Intronic
1126827022 15:52561845-52561867 GTTGAAAGTAAAAAGACTGAGGG + Intronic
1126985346 15:54300566-54300588 GAGGACAGAACAAGGATTGGAGG - Intronic
1127540979 15:59938761-59938783 GTGGGCAGCAGACAGACTGGAGG + Intergenic
1129766182 15:78170050-78170072 GATGACATTCCAAAGACTGGAGG + Exonic
1130286679 15:82561219-82561241 GTGGACACTAAAAAGACCGATGG + Intronic
1132090334 15:98943087-98943109 GTGGAAAGTGCAGAGGCTGGGGG - Intronic
1133350835 16:5098919-5098941 GGTGACAGTCCAAAGGCTGGGGG - Intergenic
1134890497 16:17837496-17837518 GTGGACACTACGAGGGCTGGAGG - Intergenic
1135849675 16:25951844-25951866 GTGGGCTGTACAAAGTCAGGTGG - Intronic
1136595656 16:31247808-31247830 GTGGACAAGACAAAGAATGCTGG - Intergenic
1138239423 16:55415139-55415161 ATGGCAAGTACAAAGACTGTGGG + Intronic
1138561018 16:57801219-57801241 AGGGACATTGCAAAGACTGGGGG + Intronic
1142280489 16:89145320-89145342 GTGGACATCATCAAGACTGGAGG + Exonic
1143035765 17:3996228-3996250 GTGGAAACTACAAAAACTGATGG - Intergenic
1144090204 17:11849495-11849517 GAGGACAGTCCAGAGAGTGGTGG - Intronic
1148716468 17:49719532-49719554 GTGGTGAGTACAAAGACAGGGGG - Intronic
1152846100 17:82600691-82600713 GTGGGCAGAACAGAGACTGCTGG - Intronic
1153521699 18:5960325-5960347 GAGGACAGAAAAAATACTGGGGG - Intronic
1155665420 18:28302203-28302225 ATGGACAGTAAAAAGACCAGTGG + Intergenic
1159820454 18:73134994-73135016 ATGGACAGTAAAAGGTCTGGAGG - Intergenic
1161836318 19:6649484-6649506 GTTGATAAAACAAAGACTGGAGG - Intergenic
1164872506 19:31657601-31657623 GTACACAATACACAGACTGGGGG - Intergenic
1164894326 19:31858011-31858033 GTAGACAGTAAAAAGATTAGTGG + Intergenic
926610546 2:14942350-14942372 GAGGACAGTACCAAGAGGGGTGG - Intergenic
927292649 2:21419978-21420000 AAGGAAAATACAAAGACTGGAGG + Intergenic
928304035 2:30151023-30151045 GTGGGCAGTACAGAAACAGGTGG + Intronic
932914493 2:75841100-75841122 GTTGAAAGTACAAAGAATGTTGG + Intergenic
933989602 2:87624775-87624797 GTGCACAGTGCAGAGACAGGAGG + Intergenic
934623299 2:95829538-95829560 TTGGACACTCCAAAGACTGAAGG + Intergenic
934810462 2:97272553-97272575 TTGGACACTCCAAAGACTGAAGG - Intergenic
934827230 2:97435386-97435408 TTGGACACTCCAAAGACTGAAGG + Intergenic
935305629 2:101733645-101733667 TGGGACAGTAGAAAGAATGGAGG + Intronic
936304241 2:111326051-111326073 GTGCACAGTGCAGAGACAGGAGG - Intergenic
937092049 2:119212950-119212972 GTGGACATTCCAGAGGCTGGAGG - Intergenic
937674816 2:124578438-124578460 GTGTACAGTTCCAAGACTGTGGG - Intronic
938246643 2:129782302-129782324 GCCGGCAGAACAAAGACTGGAGG + Intergenic
939399109 2:141668545-141668567 GTGGACAGTCCAATGGCTGTGGG + Intronic
942289969 2:174459129-174459151 GTGGACCATACAAAAACAGGTGG + Intronic
943879192 2:193117299-193117321 GTGGACAGGAGAAAGAAAGGGGG + Intergenic
946064525 2:216975156-216975178 GTGGGCTGTACTAAGACAGGGGG - Intergenic
947520575 2:230842968-230842990 GTAGACAGTACAGATTCTGGAGG + Intergenic
947856691 2:233328894-233328916 GTGGACAGGACAAGGACAGCTGG - Intronic
947934655 2:233993556-233993578 ATGGACTGTACAAAAACAGGTGG + Intronic
948356082 2:237378526-237378548 GTGGACTGTACAAAGACAATTGG - Intronic
1169811405 20:9612586-9612608 GAGGACAGTACCAAGACGGTTGG + Intronic
1170376251 20:15703463-15703485 GTGGAGAGTTTATAGACTGGGGG - Intronic
1170826501 20:19800653-19800675 GGGGACAGCTCAAAGGCTGGGGG - Intergenic
1171460766 20:25296738-25296760 GTTGACAGTACAAAGGGTCGTGG + Exonic
1177010337 21:15724598-15724620 ATGGCCAGTACAAAGCCTGTTGG - Intergenic
1178794947 21:35735242-35735264 GTGGATAGAACAAAGGCCGGGGG + Intronic
1180135245 21:45858090-45858112 GTTGACAGGTCAGAGACTGGAGG - Intronic
1180988552 22:19919888-19919910 GTGGATGGTACAAAGGCTGCGGG - Intronic
949485238 3:4531755-4531777 GTGGGCATTAGAAAGACTGGGGG - Intronic
951516978 3:23570834-23570856 GTGAACAGTACAAAAATTGGAGG - Intronic
957055095 3:75436262-75436284 GGAGACAGTCCAAAGGCTGGAGG - Intergenic
960786089 3:121373831-121373853 GTGGAGTGCACAGAGACTGGTGG - Intronic
961299747 3:125915410-125915432 GGTGACAGTCCAAAGGCTGGGGG + Intergenic
965802838 3:172512295-172512317 CTGGTTAGTACAAAGGCTGGGGG - Intronic
966949461 3:184803295-184803317 GTGGAGGGTACAGAGAGTGGGGG - Intergenic
967775838 3:193385021-193385043 GAAGACACTACAAAGACCGGAGG + Intergenic
968588906 4:1448155-1448177 GAGGACAGAACAAAGCCAGGGGG - Intergenic
968997911 4:3956572-3956594 GGTGACAGTCCAAAGGCTGGGGG - Intergenic
969756089 4:9152083-9152105 GGTGACAGTCCAAAGGCTGGGGG + Intergenic
969816412 4:9691248-9691270 GGTGACAGTCCAAAGGCTGGAGG + Intergenic
977155543 4:93568389-93568411 TTGGATGTTACAAAGACTGGAGG + Intronic
977591022 4:98827390-98827412 CTGGACAGTGAAAAGATTGGAGG - Intergenic
978033979 4:103972175-103972197 GTTAACAGTACCAAGATTGGTGG - Intergenic
981424673 4:144589444-144589466 GTGGACATTAGTAAGACTGCTGG + Intergenic
981537197 4:145812462-145812484 CTTGACAGTAGAAAGACTGCAGG - Intronic
986602879 5:9491203-9491225 GGAGACAGTAAAAAGATTGGTGG + Intronic
986603026 5:9492824-9492846 GGAGACAGTAAAAAGATTGGTGG + Intronic
986669907 5:10133526-10133548 GGGGACAGTAGAAAGACCAGTGG - Intergenic
988436834 5:31185768-31185790 GTGGAAATGACAAATACTGGAGG + Intergenic
992205195 5:74423924-74423946 GAGGACAGTACCAAGACGGATGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
994571065 5:101514479-101514501 GTGCACATTACAAAGACTAAAGG - Intergenic
996329078 5:122310728-122310750 GTGGACTCCACAAAGACTGCAGG + Intergenic
997054926 5:130430856-130430878 GTCGACAGTAAAAAGATTAGTGG + Intergenic
997184461 5:131867559-131867581 GTTGACAATAAAAAGATTGGTGG - Intronic
999217082 5:149944326-149944348 GTGGACATTGAAAAGCCTGGTGG + Exonic
1003514949 6:6810207-6810229 GTGGCAGGTACAAGGACTGGAGG + Intergenic
1003528148 6:6915572-6915594 GTGAACAGTACATAAACAGGCGG + Intergenic
1004001240 6:11599176-11599198 CTGGACAGAACAAGGATTGGGGG - Intergenic
1004309751 6:14534872-14534894 GGAGCCAGTACAAAGGCTGGAGG + Intergenic
1005329787 6:24738737-24738759 TTGGACAGTTCAAAGGCTGGGGG + Intergenic
1007321606 6:41032216-41032238 GAGGACAGAACAAAGGCAGGAGG + Intronic
1007918995 6:45589174-45589196 GTGGACCATACAAAAACAGGTGG + Intronic
1009335371 6:62482444-62482466 GTGGAGATTTCAAAGAGTGGAGG + Intergenic
1013385702 6:109628215-109628237 GTGAACAGAACAGATACTGGAGG - Intronic
1013450908 6:110280072-110280094 GAGGACAGTACCAAGAGTGATGG + Intronic
1015668507 6:135659636-135659658 GTAGGCAGTACAAAAACAGGTGG - Intergenic
1016091088 6:139980182-139980204 GTGGGCAGTTCAGGGACTGGAGG - Intergenic
1017524443 6:155230241-155230263 GTGGACACCACAAAGACGAGGGG - Intronic
1018986343 6:168640123-168640145 CTGGAGGGAACAAAGACTGGAGG - Intronic
1019926608 7:4197132-4197154 CTGGCCAGGACAGAGACTGGTGG + Intronic
1021451584 7:20787159-20787181 GAGGACAGTGCGGAGACTGGAGG + Intergenic
1022684271 7:32581157-32581179 GTGGACAGCACAGGGAATGGGGG - Intronic
1022744814 7:33160668-33160690 GTGTACAGTTCCAAGAGTGGAGG + Intronic
1022831628 7:34073369-34073391 CTGTACAGTACAAATACTGTAGG + Intronic
1025755247 7:64332228-64332250 ATGGAAAATAGAAAGACTGGGGG - Intronic
1025859821 7:65316124-65316146 GGGGTCAGTACAAAGAAGGGAGG + Intergenic
1026184090 7:68068079-68068101 GAAGAAAGTACAAAGACTGCAGG + Intergenic
1026658419 7:72277438-72277460 GTGGTCTGGACAAAGACTGGTGG - Intronic
1031572403 7:123375583-123375605 GTATAATGTACAAAGACTGGTGG - Intergenic
1035795257 8:2350269-2350291 GAAGACAGTAAAAAGATTGGGGG + Intergenic
1036064788 8:5367803-5367825 GGGGACAGTAAAAATACTGGTGG + Intergenic
1036379336 8:8227388-8227410 GGTGACAGTCCAAAGGCTGGGGG + Intergenic
1036871587 8:12437498-12437520 GGTGACAGTCCAAAGGCTGGGGG - Intergenic
1037704732 8:21309588-21309610 GTACAGAGTACAAAGAATGGGGG + Intergenic
1038059799 8:23900270-23900292 GCAGACAGAACACAGACTGGAGG - Intergenic
1038815013 8:30893419-30893441 ATGGACAGTACAATGACTTACGG + Intergenic
1038834929 8:31108941-31108963 GATGACATTCCAAAGACTGGAGG - Intronic
1039823415 8:41153663-41153685 GTGGACAGAACCAAGCCTGGGGG + Intergenic
1044796397 8:95903213-95903235 GGAGACATTGCAAAGACTGGTGG + Intergenic
1046609207 8:116405372-116405394 GTGGAGAGTGCTAACACTGGAGG + Intergenic
1047161310 8:122383143-122383165 GGGGACAGTAAAAAGATCGGTGG - Intergenic
1047791660 8:128209719-128209741 GAGGACAGTACAAAGGGTGATGG + Intergenic
1050407708 9:5327440-5327462 GTGGAGTCTACAAAGGCTGGTGG - Intergenic
1055248689 9:74276589-74276611 TTGTACAGCACAAAGCCTGGAGG + Intergenic
1058704775 9:107629241-107629263 GTGGAGAGTACCAGGACTGCGGG - Intergenic
1058857219 9:109074640-109074662 TGAGACAGTACAAAGACTGACGG + Intronic
1062656507 9:137606576-137606598 GAGGACAGAACAGAGACTGTGGG - Intronic
1186607681 X:11109197-11109219 GAGGACAGCACAAAGAATTGTGG + Intergenic
1187000315 X:15169862-15169884 GGAGACAGAAAAAAGACTGGTGG - Intergenic
1187375418 X:18748662-18748684 GTGTCCAGAACAAACACTGGTGG + Intronic
1187673731 X:21694695-21694717 GTGGACAGCACAAAAATTTGAGG - Intergenic
1188171736 X:26936152-26936174 ATGGACTTTACATAGACTGGAGG - Intergenic
1189469863 X:41305406-41305428 GTGCACAGAAAAAGGACTGGAGG - Intergenic
1195974166 X:110507923-110507945 AAGGACAGTAAAAAGATTGGTGG + Intergenic