ID: 903972941

View in Genome Browser
Species Human (GRCh38)
Location 1:27130966-27130988
Sequence TGGGCATGGGGCACTTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903972941_903972948 -9 Left 903972941 1:27130966-27130988 CCCATAGAAGTGCCCCATGCCCA 0: 1
1: 0
2: 3
3: 10
4: 117
Right 903972948 1:27130980-27131002 CCATGCCCAGGAAGGAGATAAGG 0: 1
1: 1
2: 1
3: 36
4: 335
903972941_903972952 21 Left 903972941 1:27130966-27130988 CCCATAGAAGTGCCCCATGCCCA 0: 1
1: 0
2: 3
3: 10
4: 117
Right 903972952 1:27131010-27131032 TGTCAGTGCCCACTTCCGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903972941 Original CRISPR TGGGCATGGGGCACTTCTAT GGG (reversed) Intronic
902383487 1:16063598-16063620 GGGGCATGGGGCAGTTCTTGTGG + Exonic
902742561 1:18448975-18448997 TGGGCATTGGGTCCTTCTGTGGG + Intergenic
903972941 1:27130966-27130988 TGGGCATGGGGCACTTCTATGGG - Intronic
908438057 1:64126278-64126300 TGTCCATGGGGCAGTTATATAGG + Intronic
910693331 1:89986597-89986619 TGGGTGTGGGGAACCTCTATTGG - Intergenic
912927141 1:113923150-113923172 TGGGCAGGGGACACTTCATTGGG + Intergenic
914677112 1:149913844-149913866 GGGGCTTGGGGCACTTCACTGGG + Exonic
914829544 1:151160709-151160731 TTGGCCTGGGGCAGTTTTATTGG - Exonic
917690171 1:177460554-177460576 GGGATAGGGGGCACTTCTATAGG + Intergenic
919818918 1:201460391-201460413 AGGTCATGGGGCACATCTCTGGG + Intergenic
922738170 1:228000907-228000929 GGGGCTTGGGGCACCTCTTTGGG - Intergenic
1068782216 10:60932584-60932606 TGGGGGTGGGGCACATCTAAGGG + Intronic
1069577804 10:69543382-69543404 TGGGCATTGGGCACATGGATGGG - Intergenic
1071331690 10:84566735-84566757 GGGACATGGGACACTTCTATTGG + Intergenic
1072403072 10:95125388-95125410 ATGGAATGGGGCACTTCTTTAGG - Intergenic
1074871936 10:117583713-117583735 GGGGCCTGGGGAAGTTCTATGGG + Intergenic
1078630025 11:12994031-12994053 TGTGCCTGGGGCAGTTCTAGAGG - Intergenic
1081410640 11:42753874-42753896 TGGAAATGAAGCACTTCTATTGG + Intergenic
1081905861 11:46669438-46669460 TGGACCTGGGGACCTTCTATCGG + Exonic
1082632607 11:55559664-55559686 AAGGCATGGGGCAGTTTTATAGG - Intergenic
1082633135 11:55563759-55563781 TGGGCATGGGGCAGTTTTATAGG - Intergenic
1083094158 11:60232886-60232908 GGGGCATGGAGCAGTTCCATGGG - Intronic
1083592161 11:63902247-63902269 TGGGGATGGGGCGCTGCTATTGG - Exonic
1085474096 11:76778664-76778686 AGGGCAAGGGGCACTTCTGTAGG + Intergenic
1087714716 11:101594770-101594792 TGGGCATGGATCAATTCCATTGG - Intronic
1089262074 11:117230325-117230347 TGGGCACGGGGCCCTGTTATGGG - Intronic
1102582683 12:113900743-113900765 TGAGCAAGTGGCACTTCTCTTGG + Intronic
1103327252 12:120129835-120129857 TTGGCAGGGGGCACCTCTAAAGG - Intronic
1104049111 12:125184653-125184675 TGGGCATGGGCCCCTTGTAAAGG + Intergenic
1107501117 13:40977323-40977345 TGAGAATGAAGCACTTCTATGGG - Intronic
1113060557 13:106317585-106317607 TGGTTTTGAGGCACTTCTATTGG - Intergenic
1113754324 13:112799418-112799440 TGGAGGTGGGGCAGTTCTATAGG + Intronic
1115191719 14:30753737-30753759 TGACCATGGGCCACTTCTGTAGG - Intergenic
1115949118 14:38699902-38699924 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1118397409 14:65349182-65349204 TGGGCCTGGGCCACTTCTGCAGG + Intergenic
1119248664 14:73133779-73133801 TGGGGGTGGGGCAGTTTTATAGG + Intergenic
1119484119 14:74977353-74977375 TGGGGAGGGAGCACTTCTAAAGG - Intergenic
1124144751 15:27113784-27113806 TGGGGATGTGATACTTCTATGGG + Intronic
1124229729 15:27933579-27933601 TAGGGATGGGGCAGTTTTATAGG + Intronic
1124840084 15:33233380-33233402 TGGGAATGGGATACTTCTCTAGG + Intergenic
1125086528 15:35736768-35736790 TGGGTATGGGGTACTTTTCTGGG - Intergenic
1128381374 15:67115569-67115591 TGGGCTTGGGGCACTGCGAGAGG - Intronic
1128766923 15:70256906-70256928 TGGGGGTGGGGTGCTTCTATAGG - Intergenic
1131928420 15:97412369-97412391 TGGGCATGGTGCTATTCTAGAGG + Intergenic
1134124158 16:11605057-11605079 TGGACGTGGGGCACTTGAATGGG + Intronic
1136663986 16:31792436-31792458 TGGACATGGGTCAGTCCTATTGG - Intronic
1138546377 16:57722200-57722222 AGGGCATGGGCCACTTCAACAGG + Intronic
1142248822 16:88981854-88981876 TGGCCCTGGGGCAGCTCTATCGG + Intergenic
1142771654 17:2102018-2102040 TGGGCATGGTGCACTCCTCCTGG + Intronic
1146461530 17:33049846-33049868 GGGGCATGGGGGATTTCTCTTGG - Intronic
1150993544 17:70289234-70289256 CTGGCATGGTGCACTTCTACAGG - Intergenic
1154215096 18:12409961-12409983 TGAGCATGGGGCACCTCTGCAGG - Intronic
1154306007 18:13231344-13231366 TGGGCACGGGGCGCTGCTCTTGG + Intronic
1157354115 18:46917549-46917571 TGGGCAGGGGGCACCGCTAGGGG - Intronic
1162139446 19:8577185-8577207 GGGGCATGGTGGACTTCTGTGGG - Intronic
1164219069 19:23177250-23177272 TAGGCGTGGGGCAGTTTTATAGG - Intergenic
1164590595 19:29504891-29504913 GGGGCCTGAGGCTCTTCTATAGG - Intergenic
1166396791 19:42447069-42447091 TAGGGATGGGGCAGTTTTATAGG + Intergenic
928081867 2:28319156-28319178 TGGGCATGGGGAACTTCACTGGG - Intronic
928410224 2:31048818-31048840 AGGACGTGGGGCACTTCTCTGGG - Intronic
930112198 2:47688209-47688231 TAGGGATGGGGCAGTTTTATAGG - Intergenic
931810380 2:65849027-65849049 TGGGCATTGGGCTCTTCTCCTGG - Intergenic
942513053 2:176723097-176723119 TGGGTATTGGGAACTGCTATGGG + Intergenic
942636567 2:178013267-178013289 GGGGTATGAGGCACTTGTATTGG - Intronic
942670979 2:178376299-178376321 TGGGTAGGGGGCACTTAGATAGG - Intronic
943530739 2:189077124-189077146 GGGGAATGGGCCACTTCTCTAGG - Intronic
1170870379 20:20200446-20200468 TGGCCAGGGGCCACTTTTATTGG + Intronic
1173274692 20:41569468-41569490 TTGGCATGGGGCACTACTTTAGG + Intronic
1176282225 20:64320124-64320146 AGAGCATGGGGCCCTTCTCTGGG + Intergenic
1179062073 21:37988517-37988539 TGGGGGTGGGGCAGTTTTATAGG - Intronic
1180093715 21:45544787-45544809 TGGGGATGGGGCACTGCTGTGGG - Intergenic
1181168426 22:20995270-20995292 TGGACATGGGGCACCTCTTTCGG + Intronic
1181171364 22:21011963-21011985 TGTGCATGGAGCACTTACATGGG + Intronic
1182001822 22:26926152-26926174 TGGGCAAGGGGCCCTTCAAATGG + Intergenic
1185364781 22:50432479-50432501 TGTGCAAGGGGCCCTTCTACTGG + Intronic
953363274 3:42319722-42319744 TGGGAATAGGGCACTGCAATGGG + Intergenic
954162065 3:48729916-48729938 TAGGGATGGGGCAGTTTTATAGG + Intronic
955216591 3:56989401-56989423 TGGAAATGGGGCACTGCTGTGGG - Intronic
958136151 3:89495244-89495266 TGGGCAAGAGGCACTTCTATTGG + Intergenic
960853388 3:122078556-122078578 TTGGGATGGGGCACTTGGATGGG - Intronic
963163065 3:142172416-142172438 TGGGCATGTGCCTCTTTTATGGG - Exonic
965004293 3:162998559-162998581 TGGGGATAGGGCATTTCAATAGG + Intergenic
966870349 3:184286302-184286324 TGGGCATGGGGCACTTGGGAAGG + Intronic
970295952 4:14630325-14630347 TGGGAATGGGGTAATTCTAATGG + Intergenic
971460748 4:26893239-26893261 TGGGGAGGGGGAACTTCTAGGGG - Intronic
975992405 4:80270408-80270430 TGGCCATGGTGCACTTCTCATGG - Intronic
983638279 4:169920050-169920072 TAGGGGTGGGGCACTTTTATAGG - Intergenic
984518740 4:180774863-180774885 TGGGCATGAGCCACTGCTCTTGG + Intergenic
987679605 5:21118048-21118070 TAGGGATGGGGCAGTTTTATAGG + Intergenic
987741745 5:21917291-21917313 TGGGCATGGGGCACAGACATTGG - Intronic
989613958 5:43320940-43320962 TAGGCATGGGGCAGTTTTATAGG + Intergenic
990019741 5:51110596-51110618 TGAGTATGGGGCACTGATATAGG - Intergenic
1000896072 5:166857084-166857106 TGGGCATGGAGCAGTTCTTTTGG + Intergenic
1001206375 5:169767031-169767053 TGGGCATGGGCCACTGCGCTTGG + Intronic
1001930738 5:175671096-175671118 TGGGGATGGGGCAGTGCTTTGGG + Intronic
1008054044 6:46928263-46928285 TAGGAATGTGGCAGTTCTATGGG - Intronic
1008432731 6:51437787-51437809 TTGGCATGGGAAACTTCTACAGG + Intergenic
1008546431 6:52587817-52587839 TGGGCATGGGGCAGGTCTGGTGG + Intergenic
1014328225 6:120026765-120026787 TGGGCATGGGGCAACTTTCTAGG + Intergenic
1015002413 6:128234450-128234472 TGGGCAGGGGGAAATTCTCTAGG - Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1026383722 7:69824725-69824747 TGGGCATTTGGCACTTTCATTGG + Intronic
1029874740 7:103738523-103738545 AGGGCATGAGGCACCTCTCTGGG - Intronic
1030193164 7:106829936-106829958 TAGGGGTGGGGCAGTTCTATAGG - Intergenic
1031400459 7:121321156-121321178 TAGGGATGGGGCCCTTTTATAGG - Intergenic
1033526551 7:142220264-142220286 TGGGAAAGGGGCAGTTGTATTGG - Intronic
1033526561 7:142220384-142220406 TGGGAAAGGGGCAGTTGTATCGG - Intronic
1033800406 7:144895051-144895073 TGGGAATGGTGCTCTTCTAATGG - Intergenic
1034699223 7:153082273-153082295 TGGGCATGAGCCGCTGCTATGGG + Intergenic
1039677926 8:39690387-39690409 TGGGCAGGGGGCACTTCAGCAGG + Intronic
1041727097 8:61028666-61028688 TGGTCACTGGGCCCTTCTATGGG + Intergenic
1042521397 8:69715373-69715395 TTGGCATGGGCCACATCTGTGGG - Intronic
1045983618 8:108221286-108221308 TGGGCATGAGGCAATGCTCTGGG + Intronic
1047443211 8:124897483-124897505 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1049809114 8:144555375-144555397 TGGGCCTGGGGCAGCTCTAAGGG + Intronic
1050575308 9:6988866-6988888 TGGGGAGGGGGCAGTTTTATAGG - Intronic
1052139119 9:24955922-24955944 TAGTCATGGGGCATTGCTATTGG - Intergenic
1055727701 9:79249181-79249203 TGTGCATTGGGGGCTTCTATTGG + Intergenic
1056139034 9:83656675-83656697 TGGGCAGGTGCCACTTCTACTGG + Intergenic
1059167306 9:112090373-112090395 TGGGTATGGGGCTTTTCTATGGG - Intronic
1062342784 9:136101103-136101125 TGGGCAAAGGGCACTTCTATGGG + Intergenic
1186518827 X:10187624-10187646 TGGGCATGCGGCACTCCCGTGGG + Intronic
1188200078 X:27286337-27286359 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1188201269 X:27294664-27294686 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1192731912 X:73809134-73809156 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1192913572 X:75631665-75631687 TAGGGATGGGGCAGTTTTATAGG + Intergenic
1193418834 X:81258637-81258659 TGGCCATGGGCCATTTCTAAGGG + Intronic
1198834647 X:140791410-140791432 AGGTAATAGGGCACTTCTATAGG - Intergenic
1200527101 Y:4287113-4287135 TAGGCGTGGGGCAGTTTTATAGG - Intergenic
1200675782 Y:6144759-6144781 TGGGAGTGGGGCAGTTTTATAGG - Intergenic
1200986571 Y:9307152-9307174 TGGGCATGGGGGATTTCATTGGG + Intergenic