ID: 903982705

View in Genome Browser
Species Human (GRCh38)
Location 1:27201393-27201415
Sequence TTACCGTGGTGAAGGGCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903982705_903982712 15 Left 903982705 1:27201393-27201415 CCGGATGCCCTTCACCACGGTAA 0: 1
1: 1
2: 1
3: 3
4: 58
Right 903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG No data
903982705_903982710 12 Left 903982705 1:27201393-27201415 CCGGATGCCCTTCACCACGGTAA 0: 1
1: 1
2: 1
3: 3
4: 58
Right 903982710 1:27201428-27201450 CGTCCGCCTCGAAGGTGACCCGG No data
903982705_903982716 25 Left 903982705 1:27201393-27201415 CCGGATGCCCTTCACCACGGTAA 0: 1
1: 1
2: 1
3: 3
4: 58
Right 903982716 1:27201441-27201463 GGTGACCCGGCGGGTGCTGGTGG No data
903982705_903982709 4 Left 903982705 1:27201393-27201415 CCGGATGCCCTTCACCACGGTAA 0: 1
1: 1
2: 1
3: 3
4: 58
Right 903982709 1:27201420-27201442 CTCATTCTCGTCCGCCTCGAAGG No data
903982705_903982713 16 Left 903982705 1:27201393-27201415 CCGGATGCCCTTCACCACGGTAA 0: 1
1: 1
2: 1
3: 3
4: 58
Right 903982713 1:27201432-27201454 CGCCTCGAAGGTGACCCGGCGGG No data
903982705_903982715 22 Left 903982705 1:27201393-27201415 CCGGATGCCCTTCACCACGGTAA 0: 1
1: 1
2: 1
3: 3
4: 58
Right 903982715 1:27201438-27201460 GAAGGTGACCCGGCGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903982705 Original CRISPR TTACCGTGGTGAAGGGCATC CGG (reversed) Intergenic
902130709 1:14258097-14258119 CTACCGTGATGAAGGGTCTCAGG - Intergenic
903840588 1:26236163-26236185 TTACAGTAGTGAAGGTCATATGG - Intronic
903982705 1:27201393-27201415 TTACCGTGGTGAAGGGCATCCGG - Intergenic
906496751 1:46310026-46310048 TTACCGTGCAGAAGGCCAGCTGG - Intronic
921886639 1:220313897-220313919 TTACAGTGTGGAAGGGCAGCTGG + Intergenic
1075446739 10:122518533-122518555 TTGCCGTGGTAAAGGGAAACCGG + Intergenic
1087756337 11:102058162-102058184 TTCCGGGGGTGGAGGGCATCAGG - Intronic
1099973836 12:89525877-89525899 TTACCGTGGCTGAGGCCATCGGG + Exonic
1101542889 12:105681267-105681289 TTACCGTGGTGAAAGGCTGGAGG - Intergenic
1111828437 13:93297301-93297323 CTACCATGGGGGAGGGCATCAGG + Intronic
1112587400 13:100731427-100731449 TTAAATTGGTGAAGGGGATCAGG - Intergenic
1113306249 13:109082272-109082294 TTACCTTCCTCAAGGGCATCTGG - Intronic
1115323036 14:32106003-32106025 TTAACCTGTTGAAGGACATCAGG + Intronic
1117065555 14:52010226-52010248 TTACTGATTTGAAGGGCATCTGG + Exonic
1117765424 14:59077081-59077103 TTACCTTGGAGATTGGCATCGGG - Intergenic
1121646658 14:95522383-95522405 TTCCCTTGTTGAAGGACATCCGG + Intergenic
1122877660 14:104676379-104676401 TTCCTGTGGGGAAGGGCCTCAGG + Intergenic
1130549299 15:84879613-84879635 TCCCCGCGGTAAAGGGCATCTGG - Intergenic
1130563246 15:84974940-84974962 TTAACATGGTACAGGGCATCAGG + Intergenic
1131262323 15:90893793-90893815 GTACCGTAGTTAAGGGCCTCAGG - Exonic
1137353811 16:47738580-47738602 TTAACCTGATGAAGGGCATCTGG - Intergenic
1145787769 17:27605192-27605214 TTAGCATGATGAAGGGCCTCAGG + Intronic
1145816428 17:27798283-27798305 TCATCCTGGTGAAGGGCATCAGG - Intronic
1147764419 17:42824140-42824162 CTCCCGAGGTGAAGAGCATCGGG - Exonic
1149691050 17:58576921-58576943 TTTACTTGGTGAAGGACATCCGG + Intronic
1152465541 17:80464254-80464276 TTATCCTGGGAAAGGGCATCCGG - Intergenic
1152618163 17:81347143-81347165 CTGCCGTGGTGAAGGCAATCGGG - Intergenic
1157524479 18:48370165-48370187 TTCACTTGTTGAAGGGCATCTGG - Intronic
1164826737 19:31289663-31289685 GAACCGTGCTGCAGGGCATCTGG - Intronic
948405723 2:237717478-237717500 TTCCCCAGGTGAAGGGCCTCGGG - Intronic
1173975613 20:47184321-47184343 TTACGGTGGTGAAGGGCATGGGG - Intronic
1174118749 20:48246551-48246573 TGACCCTGGGGAAGGGCAGCAGG - Intergenic
1178684379 21:34699848-34699870 TTCCTGTGGTGAAGTGCATGGGG + Intronic
950436403 3:12983079-12983101 TTACAGTGGGGAAGGCCCTCAGG - Intronic
959509305 3:107191761-107191783 TTAACCTGTTGAAGGACATCTGG - Intergenic
960842301 3:121972379-121972401 GTTCCGTGGTGAAGTGCATGGGG - Intergenic
962703590 3:138022273-138022295 TTGCCATGGTCAAGGGCACCAGG + Intronic
964935895 3:162086630-162086652 TTACTTTGTTGAAGGGCCTCAGG - Intergenic
975393774 4:73852235-73852257 TAACAGTGGTGAAGGGTGTCAGG - Intergenic
978459924 4:108940446-108940468 GTAGGGTGGTGAGGGGCATCAGG - Intronic
980379777 4:131997706-131997728 TTACCAAGGTGAGTGGCATCAGG + Intergenic
996212464 5:120828186-120828208 TAAATGTGGTCAAGGGCATCGGG + Intergenic
997479985 5:134177517-134177539 TTACCGTGGAGAATGGAAGCTGG - Intronic
1000285634 5:159823958-159823980 TTACCCTGGTGAGGGGACTCTGG + Intergenic
1002761058 6:202729-202751 TTACCCAGTTGAAGGACATCTGG - Intergenic
1006794460 6:36722725-36722747 CTACCGTGGGTAAGGGCATTGGG + Exonic
1007769141 6:44179564-44179586 CTAGGGTGGTGAAGGGCCTCAGG - Intronic
1011706099 6:90003021-90003043 TCACCCTGGTGTAGGCCATCAGG + Intronic
1012766469 6:103372867-103372889 TTCACCTGTTGAAGGGCATCTGG + Intergenic
1015465152 6:133541104-133541126 TTACAGTGTTGAAGGAAATCAGG + Intergenic
1024219335 7:47275749-47275771 TAAACGTGGTCAAGGGCATCGGG - Exonic
1026732812 7:72925747-72925769 TTACCGTGGGGAAGGCCTCCTGG - Intronic
1031406829 7:121396284-121396306 TTGCCGGGGTGAGGGGCAGCCGG - Exonic
1032578566 7:133081857-133081879 TCACCGTGGTGAAGGGCATCCGG - Exonic
1033825111 7:145179683-145179705 TTACTCTGGTGAATGGCACCAGG + Intergenic
1035069532 7:156131855-156131877 TTCACCTGATGAAGGGCATCTGG + Intergenic
1050487296 9:6147719-6147741 TTACCCTGGTGAAAGGCAGTAGG + Intergenic
1056232087 9:84557346-84557368 TTACTGTGGTGTAGGGCAAAGGG - Intergenic
1189069164 X:37846449-37846471 TTAAAGTGTTAAAGGGCATCAGG + Intronic
1189109820 X:38277715-38277737 TTACAGTGTTGAAGGGGATATGG - Intronic
1189667509 X:43372744-43372766 ATAGCCTGGTGAAGGGGATCTGG - Intergenic
1189695059 X:43655001-43655023 TGACCGTGGAGAAGGGCTGCGGG + Intronic
1191987479 X:66997866-66997888 TAAACGTGGTTAAGGGAATCAGG - Intergenic
1197596082 X:128465673-128465695 TTATCTGGGTGCAGGGCATCAGG + Intergenic