ID: 903982706

View in Genome Browser
Species Human (GRCh38)
Location 1:27201400-27201422
Sequence GAGAACATTACCGTGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903982706_903982713 9 Left 903982706 1:27201400-27201422 CCCTTCACCACGGTAATGTTCTC 0: 1
1: 1
2: 0
3: 7
4: 78
Right 903982713 1:27201432-27201454 CGCCTCGAAGGTGACCCGGCGGG No data
903982706_903982712 8 Left 903982706 1:27201400-27201422 CCCTTCACCACGGTAATGTTCTC 0: 1
1: 1
2: 0
3: 7
4: 78
Right 903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG No data
903982706_903982709 -3 Left 903982706 1:27201400-27201422 CCCTTCACCACGGTAATGTTCTC 0: 1
1: 1
2: 0
3: 7
4: 78
Right 903982709 1:27201420-27201442 CTCATTCTCGTCCGCCTCGAAGG No data
903982706_903982719 30 Left 903982706 1:27201400-27201422 CCCTTCACCACGGTAATGTTCTC 0: 1
1: 1
2: 0
3: 7
4: 78
Right 903982719 1:27201453-27201475 GGTGCTGGTGGTCCCACCCATGG 0: 1
1: 0
2: 0
3: 20
4: 183
903982706_903982716 18 Left 903982706 1:27201400-27201422 CCCTTCACCACGGTAATGTTCTC 0: 1
1: 1
2: 0
3: 7
4: 78
Right 903982716 1:27201441-27201463 GGTGACCCGGCGGGTGCTGGTGG No data
903982706_903982710 5 Left 903982706 1:27201400-27201422 CCCTTCACCACGGTAATGTTCTC 0: 1
1: 1
2: 0
3: 7
4: 78
Right 903982710 1:27201428-27201450 CGTCCGCCTCGAAGGTGACCCGG No data
903982706_903982715 15 Left 903982706 1:27201400-27201422 CCCTTCACCACGGTAATGTTCTC 0: 1
1: 1
2: 0
3: 7
4: 78
Right 903982715 1:27201438-27201460 GAAGGTGACCCGGCGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903982706 Original CRISPR GAGAACATTACCGTGGTGAA GGG (reversed) Intergenic
902126002 1:14211911-14211933 GACAAAATTAACGGGGTGAAGGG - Intergenic
903982706 1:27201400-27201422 GAGAACATTACCGTGGTGAAGGG - Intergenic
904818973 1:33228132-33228154 GAGGACATTACAGAGGGGAAGGG - Intergenic
913275868 1:117137176-117137198 TAGACCATTACTGTGGGGAAGGG + Intergenic
914983706 1:152438954-152438976 GAGGACAATGCAGTGGTGAAGGG + Intergenic
915235984 1:154482649-154482671 GAGAAGAGTACTATGGTGAATGG - Exonic
917660472 1:177172342-177172364 AAGAACATTGCTGTGCTGAAAGG + Intronic
918903292 1:190454513-190454535 GAAAACATTACTATGGTGCATGG + Intronic
919622604 1:199879907-199879929 CAGTACAATACAGTGGTGAACGG - Intergenic
922087176 1:222361626-222361648 GAGAACATTAGGGTAGGGAAAGG + Intergenic
1063780153 10:9313530-9313552 GAGATCTTTTCAGTGGTGAAGGG - Intergenic
1065426531 10:25610575-25610597 AAGAACATTACACTGGGGAAAGG - Intergenic
1067013681 10:42738786-42738808 CAGAACAAGACCGTGTTGAAAGG + Intergenic
1080053371 11:27880018-27880040 GAGGAAATTAACGTGGTGAATGG + Intergenic
1080617176 11:33954760-33954782 GAGAAGATTAAGGAGGTGAAGGG - Intergenic
1082687292 11:56256672-56256694 AAGAATATTACAGTGGTGAGTGG + Intergenic
1082961372 11:58921527-58921549 GAGAATAATAACGTGGAGAATGG - Intronic
1098621836 12:72610705-72610727 GAGAACATCACCATGGTGCAGGG + Intronic
1099305089 12:80944187-80944209 GGGAATCTTACCATGGTGAAGGG + Intronic
1102448444 12:113022326-113022348 GAGAACAGTACCAAGGGGAATGG + Intergenic
1102524923 12:113505651-113505673 GAAAACATCACCTTGGGGAAGGG + Intergenic
1104387125 12:128360646-128360668 AATAACTTGACCGTGGTGAATGG + Intronic
1109326410 13:60872809-60872831 GAAAACATTATCATGGTGGAAGG + Intergenic
1128878253 15:71220038-71220060 AAGAAGATTACCCTGGTTAAAGG - Intronic
1131741794 15:95400734-95400756 GAGAAAATTATTATGGTGAAAGG + Intergenic
1132070011 15:98768130-98768152 GAGAACAGAACTGTGGAGAAAGG - Intronic
1138356986 16:56390000-56390022 GAGGACATTGAGGTGGTGAATGG - Intronic
1140910852 16:79450946-79450968 GTGAACATTACCGTGAAAAAAGG - Intergenic
1144296189 17:13877159-13877181 GAGAACATTACCAAGGTGCATGG - Intergenic
1153748008 18:8200225-8200247 GACATCATTGCCGTGGTGCAGGG + Intronic
1154938402 18:21085764-21085786 GAGAACATTGAGGTGGTGATGGG - Intronic
1157304485 18:46507298-46507320 GAGAACATTACTGGGGAGTATGG - Intronic
1160326004 18:77948772-77948794 GAGATCATCACCGTGTTAAATGG + Intergenic
1161580212 19:5076800-5076822 GACAACATGACCCTGGGGAAAGG - Intronic
1165121906 19:33565330-33565352 GAGCTCACTACAGTGGTGAAGGG - Intergenic
1165828046 19:38716861-38716883 GAGAACAGTACAGTGATGCAGGG + Intronic
933318698 2:80745532-80745554 TAGAACATTACAGTGGTCAAAGG - Intergenic
933644079 2:84795611-84795633 AGGAACACTACAGTGGTGAATGG + Intronic
934986766 2:98893147-98893169 GAGAGGATTACCTTGGAGAATGG - Intronic
941868637 2:170360701-170360723 GAGAGCCTCTCCGTGGTGAATGG + Intronic
947631126 2:231653791-231653813 GAGAAAACCACTGTGGTGAAAGG - Intergenic
1179644154 21:42765480-42765502 GAGCACATGACCCTGGTGAGTGG + Exonic
1181562469 22:23713944-23713966 GAGAGCAGCACCGTGGGGAAGGG + Intergenic
1181676864 22:24460442-24460464 TAAAAAATTACCATGGTGAAGGG + Intergenic
951857035 3:27208852-27208874 GAGAACATTTCCGTGATGCCAGG - Intronic
956079224 3:65539809-65539831 GTGAAAACTACTGTGGTGAAAGG - Intronic
957131236 3:76224453-76224475 GAGAACATAATTGTGGAGAAAGG - Intronic
959287209 3:104430093-104430115 GAGAACAGTAACTTGGAGAAAGG - Intergenic
960757963 3:121038844-121038866 CAGAACATTACCGGGGTTAAAGG - Intronic
962615683 3:137124241-137124263 GAGACAATAAACGTGGTGAAGGG - Intergenic
967479986 3:189961856-189961878 GAGAACAATACCTTGGAAAAGGG + Intronic
970255555 4:14165889-14165911 GAGAACATTTTCCTGGGGAATGG - Intergenic
978961958 4:114690797-114690819 GAGAACACTACAGTGCTGACTGG + Intergenic
984988537 4:185354673-185354695 GAAAGCATCACCTTGGTGAAAGG + Intronic
988889732 5:35601879-35601901 GAGAACATTTCCATTGAGAATGG + Intergenic
989299789 5:39877368-39877390 GACAACAGTACAGTGGGGAAAGG - Intergenic
997029225 5:130104409-130104431 AAGCACATTACCGTGATGGAAGG - Intronic
1000091698 5:157935193-157935215 GAGAAAATTATCACGGTGAAAGG - Intergenic
1001915976 5:175560342-175560364 GAGAGAATTATAGTGGTGAAAGG - Intergenic
1005042798 6:21614641-21614663 GAGAATGTTACCCTGGTGAGGGG - Intergenic
1007971180 6:46053797-46053819 GAGAACTTTACCCTGGGGAGAGG + Intronic
1010060425 6:71616183-71616205 GAGAACAGTACCATGTGGAATGG + Intergenic
1010882584 6:81198206-81198228 GAGAATATGACCCAGGTGAAGGG + Intergenic
1013174673 6:107667318-107667340 GAGAACATAAGCTTGGTTAATGG + Intergenic
1013351682 6:109311571-109311593 AAAAATATTACCCTGGTGAATGG - Intergenic
1015131685 6:129818241-129818263 TAGAACAATTCCGTAGTGAAAGG + Intergenic
1025227327 7:57177115-57177137 GAGAGCAGCACCGTGGGGAAAGG + Intergenic
1026592268 7:71707218-71707240 GAGCACATAACTGTGGTGAATGG - Intronic
1032578567 7:133081864-133081886 GAGAACATCACCGTGGTGAAGGG - Exonic
1038001176 8:23392390-23392412 GATGACATTACCTTGATGAATGG - Intronic
1038176125 8:25183876-25183898 GAGAGCATTCCCGTGGAGAAAGG - Intergenic
1039117618 8:34109993-34110015 GAGAACATCACGGTTGGGAATGG + Intergenic
1044584463 8:93856695-93856717 GAGAACATTCCTGGGGTGAGGGG - Intergenic
1051364987 9:16315563-16315585 GAGAACATTGCAGAGGTGTAGGG - Intergenic
1051646294 9:19272076-19272098 GAAATCATTACAGTGGAGAAAGG + Intronic
1052842716 9:33306795-33306817 GAGAAGAGCACCGTGGGGAAAGG - Intronic
1053131418 9:35617746-35617768 GAGCACAATACCCTGGGGAAAGG - Intronic
1055729664 9:79267529-79267551 GAGAATATTACTGTGCTCAAGGG - Intergenic
1055856034 9:80690033-80690055 GAGAACAGTACCATGGAGGATGG - Intergenic
1187793228 X:22973474-22973496 GAGGACATTTTCCTGGTGAATGG - Intergenic
1187838646 X:23461621-23461643 GAGAAAATTACCTTCGTTAAAGG - Intergenic
1188219263 X:27520322-27520344 GAGAACATTAACGTAATCAATGG + Intergenic
1188307840 X:28580598-28580620 GAGAATATTATAGTGGTGTAAGG - Intergenic
1193834398 X:86323728-86323750 GAGAACTTTGCCGTTGTGCAGGG - Intronic
1198871348 X:141179606-141179628 GGGAAGATCACAGTGGTGAAAGG + Intergenic
1201440061 Y:13998657-13998679 GTGAATATTACCATGGTCAATGG + Intergenic
1201444510 Y:14044051-14044073 GTGAATATTACCATGGTCAATGG - Intergenic