ID: 903982707

View in Genome Browser
Species Human (GRCh38)
Location 1:27201401-27201423
Sequence TGAGAACATTACCGTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903982707_903982713 8 Left 903982707 1:27201401-27201423 CCTTCACCACGGTAATGTTCTCA 0: 1
1: 1
2: 0
3: 16
4: 121
Right 903982713 1:27201432-27201454 CGCCTCGAAGGTGACCCGGCGGG No data
903982707_903982709 -4 Left 903982707 1:27201401-27201423 CCTTCACCACGGTAATGTTCTCA 0: 1
1: 1
2: 0
3: 16
4: 121
Right 903982709 1:27201420-27201442 CTCATTCTCGTCCGCCTCGAAGG No data
903982707_903982719 29 Left 903982707 1:27201401-27201423 CCTTCACCACGGTAATGTTCTCA 0: 1
1: 1
2: 0
3: 16
4: 121
Right 903982719 1:27201453-27201475 GGTGCTGGTGGTCCCACCCATGG 0: 1
1: 0
2: 0
3: 20
4: 183
903982707_903982710 4 Left 903982707 1:27201401-27201423 CCTTCACCACGGTAATGTTCTCA 0: 1
1: 1
2: 0
3: 16
4: 121
Right 903982710 1:27201428-27201450 CGTCCGCCTCGAAGGTGACCCGG No data
903982707_903982712 7 Left 903982707 1:27201401-27201423 CCTTCACCACGGTAATGTTCTCA 0: 1
1: 1
2: 0
3: 16
4: 121
Right 903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG No data
903982707_903982715 14 Left 903982707 1:27201401-27201423 CCTTCACCACGGTAATGTTCTCA 0: 1
1: 1
2: 0
3: 16
4: 121
Right 903982715 1:27201438-27201460 GAAGGTGACCCGGCGGGTGCTGG No data
903982707_903982716 17 Left 903982707 1:27201401-27201423 CCTTCACCACGGTAATGTTCTCA 0: 1
1: 1
2: 0
3: 16
4: 121
Right 903982716 1:27201441-27201463 GGTGACCCGGCGGGTGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903982707 Original CRISPR TGAGAACATTACCGTGGTGA AGG (reversed) Intergenic
900903185 1:5530933-5530955 TGAGAACAGCACCAAGGTGATGG - Intergenic
902129130 1:14243452-14243474 TTAGAACATAAACGTGGCGATGG + Intergenic
903982707 1:27201401-27201423 TGAGAACATTACCGTGGTGAAGG - Intergenic
905648937 1:39643760-39643782 TGAGAACAGTACCAAGGGGATGG - Intergenic
909102930 1:71373025-71373047 TGAGAACATTACTGCGGATAAGG - Intergenic
914983705 1:152438953-152438975 TGAGGACAATGCAGTGGTGAAGG + Intergenic
917365882 1:174231821-174231843 TGAGAACAGCACCGAGGGGATGG + Intronic
918768200 1:188516569-188516591 TGAGAACATTAGTGTTTTGAAGG - Intergenic
919283087 1:195517713-195517735 TGAGAACAGTACCAAGGGGATGG - Intergenic
923935606 1:238756797-238756819 TAAGTACATTACTCTGGTGAGGG + Intergenic
1065002389 10:21348664-21348686 TGAAATCATTACTGTGGTGAGGG + Intergenic
1065126997 10:22583537-22583559 TGAGGACATTAGCATGGTGGGGG + Intronic
1069537482 10:69265648-69265670 TGAGGACAGCATCGTGGTGAAGG + Exonic
1069665245 10:70150905-70150927 GGATAACATTACTGGGGTGAGGG - Exonic
1073992423 10:109277459-109277481 AGAGAGCATTACCATGGTGAAGG - Intergenic
1075567769 10:123517232-123517254 TGAGAACATTTCTGGGGTGGAGG - Intergenic
1075646594 10:124100862-124100884 TGAGAACAGTACCAGGGTAACGG - Intergenic
1075883470 10:125875722-125875744 TGAGAAAATTATGATGGTGAAGG + Intronic
1077517269 11:3009569-3009591 TGAAAACAAAACCGTGGCGATGG + Intronic
1081124475 11:39306077-39306099 TGAGAATATTGTCATGGTGATGG + Intergenic
1089325862 11:117656395-117656417 TGAGAACCTTCCCGTGGTGTAGG - Intronic
1090453971 11:126831259-126831281 ATGGAACATTACCTTGGTGAAGG - Intronic
1090507130 11:127328153-127328175 TTAGAACATCACCAAGGTGATGG - Intergenic
1095903687 12:47355324-47355346 TGTGAACAATACCTGGGTGATGG - Intergenic
1098621835 12:72610704-72610726 TGAGAACATCACCATGGTGCAGG + Intronic
1102524922 12:113505650-113505672 TGAAAACATCACCTTGGGGAAGG + Intergenic
1103970226 12:124666136-124666158 GGATACCATTTCCGTGGTGAAGG - Intergenic
1107164652 13:37270237-37270259 TGTGAGCATTACTGTGGGGAGGG + Intergenic
1107312554 13:39094683-39094705 TGAGAAATTTATTGTGGTGAAGG + Intergenic
1108247677 13:48533362-48533384 CGAGAACATAACCCTGGAGAAGG - Intergenic
1108248910 13:48545451-48545473 TGAGATAATTACCCTTGTGATGG + Intergenic
1108263917 13:48685301-48685323 TGAGAACAGCACCGAGGGGACGG + Intronic
1111240191 13:85463859-85463881 TGAGAACAATACCATGTGGATGG + Intergenic
1114315229 14:21503652-21503674 TCAGGTCATTACCGTGGAGATGG + Exonic
1115205206 14:30896171-30896193 TGAAAACATTACCGTAGTGGTGG - Intronic
1115348790 14:32370708-32370730 TGAAAACATTACTGTTATGAAGG + Intronic
1116971934 14:51075281-51075303 TCAGAACATTAACGTGGAGTAGG - Intronic
1120858698 14:89235200-89235222 TGAAAACATCACCATGGAGAGGG + Intronic
1125081920 15:35684714-35684736 TGAGAACAGTACTGAGGGGATGG + Intergenic
1126563002 15:50064921-50064943 TGAGAACAACACCGAGGGGATGG + Intronic
1127170430 15:56294966-56294988 TGAGAACATCACAGTAGTGAAGG + Intronic
1130429530 15:83832561-83832583 TGTGAACATTATCCTGCTGAAGG - Intronic
1133452256 16:5913425-5913447 TGAGCTCATTACTGTGGGGAAGG - Intergenic
1133646124 16:7766366-7766388 TGAGAAAATTTCCCAGGTGATGG - Intergenic
1135621239 16:23957730-23957752 TGACCACAGTACCCTGGTGATGG - Intronic
1137300159 16:47142048-47142070 TGACAACCTTACCGTAGTGAGGG + Intronic
1139799671 16:69512024-69512046 TGAGAACACAATGGTGGTGAGGG + Intergenic
1143652134 17:8269702-8269724 TGAGAACAATGAGGTGGTGAGGG - Exonic
1143947196 17:10603922-10603944 TAATAACATTACCTTGGTCAGGG + Intergenic
1146202603 17:30872910-30872932 TGAGAAAATTTCCATAGTGAGGG - Intronic
1149456219 17:56790795-56790817 TGAGAACAGTACCAAGGGGATGG - Intergenic
1154938403 18:21085765-21085787 TGAGAACATTGAGGTGGTGATGG - Intronic
1158056555 18:53287066-53287088 TTAGAAAATTAATGTGGTGATGG - Intronic
1161455674 19:4368597-4368619 TGAGGACAGTCCCGTGGTGTGGG - Intronic
1165791139 19:38493255-38493277 TGAGAGGATTACCATGCTGAGGG + Intronic
925263945 2:2551416-2551438 TGAGTAGATGACGGTGGTGATGG + Intergenic
926248440 2:11138665-11138687 TGAGGACAGTACCATGGGGATGG - Intronic
927225593 2:20762831-20762853 TGAAAATATTACCCTGGTGATGG - Intronic
929002937 2:37366110-37366132 TGAGGACATTATGGGGGTGAAGG + Intronic
929743779 2:44633826-44633848 TGTGAACATTACATTGTTGAGGG + Intronic
933484968 2:82909606-82909628 TGAGAACAGCACCCAGGTGATGG - Intergenic
933628732 2:84632446-84632468 TGAGAACATGTCTGTGGTCATGG - Intronic
935657231 2:105434048-105434070 TGAGAACATTACAGGTGAGAAGG - Intronic
936024965 2:109024498-109024520 TGAGAAAATTACAGCAGTGAGGG + Intergenic
936233280 2:110722902-110722924 TGAGAACAGCACCAAGGTGATGG - Intergenic
939300138 2:140326304-140326326 TGAGAACTGTACCTTCGTGAAGG - Intronic
940879261 2:158930032-158930054 TGAGCTCATTACTGTGGGGAGGG - Intergenic
947096087 2:226568461-226568483 TGAGAACAGTACCAGAGTGATGG - Intergenic
947162419 2:227227770-227227792 TGAGATCATTACAGTGCTGATGG + Intronic
947407142 2:229790496-229790518 TGTGAAAATTACTGTGGTGGCGG + Intronic
1169208428 20:3752768-3752790 TGGGAACATTATTGTGGTGGAGG + Exonic
1169996240 20:11560200-11560222 TGAGAACAGTACGGAGGAGAAGG + Intergenic
1176728727 21:10468134-10468156 TGCGAACATCACTGTAGTGAAGG + Intergenic
1179671836 21:42954748-42954770 TAAGAACAATATCGTGGTGGGGG - Intergenic
1181562468 22:23713943-23713965 TGAGAGCAGCACCGTGGGGAAGG + Intergenic
1181676863 22:24460441-24460463 TTAAAAAATTACCATGGTGAAGG + Intergenic
1184360142 22:44011721-44011743 TGAGAACATTGCTGTGGCCAGGG - Intronic
950457256 3:13100089-13100111 TGAGAACAGTGGCGTGGCGAGGG + Intergenic
951351783 3:21615174-21615196 TGAGCTCATTACCATGGTGAGGG - Intronic
951896685 3:27616197-27616219 TGATTACATTACCGTGATGGAGG + Intergenic
958965819 3:100556931-100556953 TGACAACATTAACTTGGTTAAGG - Exonic
960592530 3:119379534-119379556 TGAGATCCTAACCGTGGTGATGG - Intronic
962756132 3:138466924-138466946 TGAGCTCATTACTGTGGGGAGGG + Intronic
963500439 3:146119125-146119147 TGAGAACATCACTAGGGTGATGG - Intronic
965344354 3:167529364-167529386 TGAGAAAATTAAAGTGGTGCTGG - Intronic
968856148 4:3124551-3124573 TGAGGAAATTACCCTGGGGACGG + Intronic
970945147 4:21682245-21682267 TGAGAACAGTACCAAGGGGATGG + Intronic
971473765 4:27053522-27053544 TGACCACATTTCAGTGGTGAGGG - Intergenic
972936227 4:44139110-44139132 TGAGCACATTTCAGGGGTGAGGG - Intergenic
974459496 4:62168814-62168836 TAAGCACATTACCTTGATGATGG + Intergenic
976207383 4:82636004-82636026 TTAGAACATTTCCATGGTCATGG + Intronic
976306088 4:83560751-83560773 TGAGGACAGTACCATGGGGATGG - Intronic
978376521 4:108079968-108079990 TGAGAAAATTCCCATTGTGATGG - Intronic
981686881 4:147464731-147464753 TGAAAACATTCCAGTGGAGATGG - Intergenic
982214536 4:153069257-153069279 TGAGAACAGTACCAAGGGGATGG - Intergenic
984182662 4:176503942-176503964 TGAGAATATCAGAGTGGTGATGG - Intergenic
986642580 5:9886964-9886986 TGAGAACATTCCAGTGGCGGTGG - Intergenic
993164135 5:84330551-84330573 TAAAAACATTACCTTGATGAAGG + Intronic
993840048 5:92866473-92866495 TGAGAACATCATCATGGTGATGG - Intergenic
994287564 5:97988463-97988485 TAACAACATTACCAAGGTGAAGG + Intergenic
995362292 5:111311097-111311119 TGAGAGCATTACCTGGGTGAAGG + Intronic
995927315 5:117389863-117389885 TGAGAACAGCACCGAGGGGATGG - Intergenic
996888532 5:128389199-128389221 TAAGAACATGCCAGTGGTGATGG + Intronic
998188268 5:139999807-139999829 TGAGAACATTTCAGTGCTGAGGG + Intronic
998354123 5:141520433-141520455 TGAGCTCATTACTGTGGGGAGGG - Intronic
999363425 5:151005579-151005601 TAAGAGCATTACTGTGGTGGTGG + Intergenic
999436418 5:151566951-151566973 TTTGAATATTACTGTGGTGAAGG - Exonic
1004284478 6:14307991-14308013 TGAGGACAGTACCGAGGAGATGG - Intergenic
1005042799 6:21614642-21614664 TGAGAATGTTACCCTGGTGAGGG - Intergenic
1009443134 6:63706214-63706236 AGAGAAAATTACCGTGGAGCAGG - Exonic
1009457086 6:63870263-63870285 TGTGAACATTACTGAGGTCAGGG - Intronic
1010882583 6:81198205-81198227 TGAGAATATGACCCAGGTGAAGG + Intergenic
1015580106 6:134714982-134715004 TGGGAACATTCCGCTGGTGAAGG - Intergenic
1016688708 6:146911007-146911029 TGAGGAACTTACTGTGGTGAAGG - Intergenic
1021152538 7:17168886-17168908 TGTGAATATTACCTTGTTGAAGG - Intergenic
1031049229 7:116928272-116928294 TGATAACATTACCCAGGAGAAGG + Intergenic
1031354287 7:120770992-120771014 GAAGAAAATTACTGTGGTGAAGG - Intergenic
1032578568 7:133081865-133081887 TGAGAACATCACCGTGGTGAAGG - Exonic
1034891101 7:154839953-154839975 TGAGGACATTAGCATGGAGATGG + Intronic
1036235234 8:7034262-7034284 TGAGAACACTGCTGTGGTGTGGG - Intergenic
1037634565 8:20690156-20690178 TGAGAACAGAACCATCGTGATGG + Intergenic
1037941704 8:22956394-22956416 TGAGAACAGCACTGAGGTGATGG - Intronic
1042785372 8:72539568-72539590 TGAGAACACTAACATGGAGAGGG - Intronic
1044155125 8:88836959-88836981 TGAGAACAGTACCTCGGAGATGG + Intergenic
1044584464 8:93856696-93856718 GGAGAACATTCCTGGGGTGAGGG - Intergenic
1050308443 9:4329201-4329223 TCAGAACATTATCGTGGGAATGG - Intronic
1050673303 9:8023040-8023062 CAGGAACATTGCCGTGGTGAAGG - Intergenic
1051298530 9:15622509-15622531 GAATAACATTACTGTGGTGAGGG + Intronic
1052819536 9:33128024-33128046 TGTGAACATTACCAGGGTGGTGG + Intronic
1055561975 9:77530232-77530254 TGAGAACAGCACCAAGGTGAGGG - Intronic
1055729665 9:79267530-79267552 TGAGAATATTACTGTGCTCAAGG - Intergenic
1185446780 X:262163-262185 TGAGAACATTAGGGCAGTGAAGG - Intergenic
1192912897 X:75624072-75624094 TGAGAACAGCACCAAGGTGATGG + Intergenic
1194621351 X:96176275-96176297 TGAGAAAATTATGGCGGTGAAGG - Intergenic
1198230068 X:134680651-134680673 TGAGAACATTACCCAGCTAAGGG + Intronic
1198456291 X:136821180-136821202 TGAGAACAGTACCAAGGGGATGG + Intergenic
1198999363 X:142615923-142615945 TGAGAACAGTACCAAGGAGATGG - Intergenic
1199948855 X:152689454-152689476 TGAGCACAGTACCAAGGTGATGG + Intergenic
1199960821 X:152778995-152779017 TGAGCACAGTACCAAGGTGATGG - Intergenic