ID: 903982708

View in Genome Browser
Species Human (GRCh38)
Location 1:27201407-27201429
Sequence CGAGAATGAGAACATTACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 1, 2: 1, 3: 3, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903982708_903982710 -2 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982710 1:27201428-27201450 CGTCCGCCTCGAAGGTGACCCGG No data
903982708_903982716 11 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982716 1:27201441-27201463 GGTGACCCGGCGGGTGCTGGTGG No data
903982708_903982719 23 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982719 1:27201453-27201475 GGTGCTGGTGGTCCCACCCATGG 0: 1
1: 0
2: 0
3: 20
4: 183
903982708_903982713 2 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982713 1:27201432-27201454 CGCCTCGAAGGTGACCCGGCGGG No data
903982708_903982712 1 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG No data
903982708_903982709 -10 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982709 1:27201420-27201442 CTCATTCTCGTCCGCCTCGAAGG No data
903982708_903982715 8 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982715 1:27201438-27201460 GAAGGTGACCCGGCGGGTGCTGG No data
903982708_903982720 29 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982720 1:27201459-27201481 GGTGGTCCCACCCATGGCTCCGG 0: 1
1: 0
2: 3
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903982708 Original CRISPR CGAGAATGAGAACATTACCG TGG (reversed) Intergenic
900471217 1:2855945-2855967 CAAGAAGGAGAACGTTTCCGCGG + Intergenic
900582350 1:3415402-3415424 CGAGAAAGAGAACAATGCCCCGG - Intronic
903982708 1:27201407-27201429 CGAGAATGAGAACATTACCGTGG - Intergenic
911098770 1:94077533-94077555 AGAGAATGAGAACTGTACAGGGG + Intronic
911820717 1:102416790-102416812 CCAGAATGAGAACCTTATCTTGG + Intergenic
915129504 1:153687024-153687046 GGAGAATGAGAGCATCACCCTGG + Exonic
915215267 1:154336069-154336091 TGAGATAGTGAACATTACCGTGG + Intronic
915382555 1:155455053-155455075 CTAGAATGTGAAAATTACCATGG + Intronic
1064249896 10:13698893-13698915 GGAGAAGGAGAACATTTCCCAGG - Intronic
1080325377 11:31065945-31065967 CCAGAATGAAAACTTGACCGGGG - Intronic
1080425661 11:32151715-32151737 GCAGAATGAGAACAGTAACGTGG + Intergenic
1094430098 12:30359045-30359067 AGAGAATCAGAGCATTTCCGTGG + Intergenic
1095918783 12:47507940-47507962 CGAGAGAGAGAACATTTTCGTGG + Intergenic
1098621834 12:72610698-72610720 TGAGAATGAGAACATCACCATGG + Intronic
1105245476 13:18646178-18646200 CTAGAATGAGATCATTAGGGTGG + Intergenic
1106995655 13:35477202-35477224 CCAGAATGAGAAAATTACACAGG - Exonic
1110034033 13:70655788-70655810 TGAGGATGAGATCATTACAGTGG - Intergenic
1110661437 13:78062695-78062717 GGAGAATGAGAACATGGCCTTGG - Intergenic
1115686410 14:35801198-35801220 CGAGAAGGATAACATTACCATGG + Intronic
1122965410 14:105121889-105121911 TCAGAATGAGAATATTACCTGGG - Intergenic
1146667850 17:34716655-34716677 CGAGAATGAAAACACAACAGGGG + Intergenic
1149732332 17:58958658-58958680 AGAGATTGAGAAAATTATCGAGG + Intronic
1155113657 18:22742250-22742272 CAAGAATGAGACAATTACTGGGG + Intergenic
1156455947 18:37294167-37294189 CTAGAATGAGAACTTTGCTGGGG + Intronic
1160901073 19:1429017-1429039 CGAGAAGGGGGACATTCCCGTGG - Intronic
1164830922 19:31320172-31320194 TGAGAATGACAACATGACCACGG + Intronic
1165304193 19:34993610-34993632 TGAGAATCAGCACATTACCAGGG - Intergenic
928051712 2:28004047-28004069 CAAGAATGGGCACATTACAGAGG + Intronic
928367727 2:30715637-30715659 AGAGAAAGATAACATTACCCTGG + Intergenic
930988802 2:57625616-57625638 TGAGAATGTGAAAATTACCTTGG + Intergenic
935497230 2:103795599-103795621 CTAGCATGAGAACATTATGGGGG + Intergenic
937277445 2:120694503-120694525 CAATAATGAAATCATTACCGAGG - Intergenic
941094217 2:161217360-161217382 GGAGAATGAGATCATAACCATGG - Intronic
1172806007 20:37612329-37612351 AGAAAATGAGAACATTATCTTGG - Intergenic
1176452622 21:6877469-6877491 CTAGAATGAGATCATTAGGGTGG + Intergenic
1176830795 21:13742518-13742540 CTAGAATGAGATCATTAGGGTGG + Intergenic
1183586718 22:38757034-38757056 CAAGAATGACAAAATCACCGAGG + Intronic
951692623 3:25412716-25412738 CGAGAAAAAGAACATGACCATGG + Intronic
956809397 3:72849688-72849710 GGAGAATGAGATCATTACAAAGG - Intronic
958830133 3:99077201-99077223 TGAGAATGAGAACAGCACGGAGG + Intergenic
959018126 3:101159026-101159048 GGAGAATGAGAACTTTGCTGTGG - Intergenic
964652749 3:159029541-159029563 CTAGAATTAGATTATTACCGTGG - Intronic
965032663 3:163392504-163392526 TGTGAATGAGAACTTTACCAAGG + Intergenic
967710942 3:192707450-192707472 CAAGAATGAGAACAATAGCTGGG + Intronic
971848302 4:31948337-31948359 CTATTATGAGAACATTACGGGGG + Intergenic
974417252 4:61624943-61624965 TGAGAATGAGGACATTAATGAGG - Intronic
980659529 4:135839523-135839545 GGAGACTGAAAACATTACCGTGG + Intergenic
983357850 4:166687143-166687165 CGAGAAAGAGAACATTGTTGAGG - Intergenic
986642582 5:9886970-9886992 CAAGGATGAGAACATTCCAGTGG - Intergenic
987472537 5:18350945-18350967 CGAGAATGAGAACCTTCTGGGGG - Intergenic
991140999 5:63243285-63243307 TGAGGATGAGAAAATTCCCGGGG + Intergenic
997007822 5:129840301-129840323 CGATAATGAGTACATTGCCCAGG + Intergenic
998618203 5:143764549-143764571 CTATAATGAGAACAGTACAGGGG + Intergenic
1000148054 5:158472597-158472619 CTAGAATGAGAAAATTTCCAGGG + Intergenic
1002874236 6:1197361-1197383 CAGTAATGAGAACATTTCCGGGG + Intergenic
1006636984 6:35468182-35468204 CGCGAATCGGCACATTACCGGGG + Intergenic
1012410701 6:98953694-98953716 AGAGAATCAGAACATTGCAGAGG + Intergenic
1024913083 7:54468358-54468380 CTAGAATGAGCTCATTCCCGGGG - Intergenic
1026070324 7:67113067-67113089 AGAGAATGAGATCATTTCCACGG - Intronic
1026706583 7:72699201-72699223 AGAGAATGAGATCATTTCCAGGG + Intronic
1027687768 7:81298763-81298785 AGAGAATGAGCACCTTACCTTGG - Intergenic
1028749952 7:94372044-94372066 CGAGGGTGAGAACATTACCGTGG + Intergenic
1032578569 7:133081871-133081893 CGAGAATGAGAACATCACCGTGG - Exonic
1033423630 7:141224033-141224055 CTACAATGAGAACATTATGGGGG - Intronic
1038843834 8:31210751-31210773 AGAGAATGAGAACTTGACCTTGG - Intergenic
1041235975 8:55802733-55802755 AGAGAATGAGAACGTAAACGGGG - Intronic
1043040330 8:75254285-75254307 CGATAATGAGAACAGTATGGGGG + Intergenic
1050135643 9:2460790-2460812 CAAGAAATAGAACATTACTGGGG + Intergenic
1203516559 Un_GL000213v1:7046-7068 CTAGAATGAGATCATTAGGGTGG - Intergenic
1195891788 X:109703125-109703147 GGAAAATGATAACATTACTGTGG + Intronic