ID: 903982712

View in Genome Browser
Species Human (GRCh38)
Location 1:27201431-27201453
Sequence CCGCCTCGAAGGTGACCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903982705_903982712 15 Left 903982705 1:27201393-27201415 CCGGATGCCCTTCACCACGGTAA 0: 1
1: 1
2: 1
3: 3
4: 58
Right 903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG No data
903982706_903982712 8 Left 903982706 1:27201400-27201422 CCCTTCACCACGGTAATGTTCTC 0: 1
1: 1
2: 0
3: 7
4: 78
Right 903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG No data
903982708_903982712 1 Left 903982708 1:27201407-27201429 CCACGGTAATGTTCTCATTCTCG 0: 1
1: 1
2: 1
3: 3
4: 64
Right 903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG No data
903982707_903982712 7 Left 903982707 1:27201401-27201423 CCTTCACCACGGTAATGTTCTCA 0: 1
1: 1
2: 0
3: 16
4: 121
Right 903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903982712 Original CRISPR CCGCCTCGAAGGTGACCCGG CGG Intergenic
No off target data available for this crispr