ID: 903985604

View in Genome Browser
Species Human (GRCh38)
Location 1:27225759-27225781
Sequence CAGATCTAACTCTTCTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903985599_903985604 25 Left 903985599 1:27225711-27225733 CCACTGCTAGTTGGATTGCATGT No data
Right 903985604 1:27225759-27225781 CAGATCTAACTCTTCTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903985604 Original CRISPR CAGATCTAACTCTTCTAGGG GGG Intergenic
No off target data available for this crispr