ID: 903990123

View in Genome Browser
Species Human (GRCh38)
Location 1:27261574-27261596
Sequence CTGTGAGATAAATGGATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903990118_903990123 29 Left 903990118 1:27261522-27261544 CCTGTGCTAAAGCCTGTCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 170
Right 903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG 0: 1
1: 0
2: 1
3: 22
4: 194
903990120_903990123 12 Left 903990120 1:27261539-27261561 CCTCTGCAGTTTGTATGTAGAAG 0: 1
1: 0
2: 0
3: 19
4: 159
Right 903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG 0: 1
1: 0
2: 1
3: 22
4: 194
903990119_903990123 17 Left 903990119 1:27261534-27261556 CCTGTCCTCTGCAGTTTGTATGT 0: 1
1: 0
2: 3
3: 22
4: 218
Right 903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG 0: 1
1: 0
2: 1
3: 22
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903990123 Original CRISPR CTGTGAGATAAATGGATGAC TGG Intronic