ID: 903990123

View in Genome Browser
Species Human (GRCh38)
Location 1:27261574-27261596
Sequence CTGTGAGATAAATGGATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903990120_903990123 12 Left 903990120 1:27261539-27261561 CCTCTGCAGTTTGTATGTAGAAG 0: 1
1: 0
2: 0
3: 19
4: 159
Right 903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG 0: 1
1: 0
2: 1
3: 22
4: 194
903990119_903990123 17 Left 903990119 1:27261534-27261556 CCTGTCCTCTGCAGTTTGTATGT 0: 1
1: 0
2: 3
3: 22
4: 218
Right 903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG 0: 1
1: 0
2: 1
3: 22
4: 194
903990118_903990123 29 Left 903990118 1:27261522-27261544 CCTGTGCTAAAGCCTGTCCTCTG 0: 1
1: 0
2: 1
3: 9
4: 170
Right 903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG 0: 1
1: 0
2: 1
3: 22
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903990123 Original CRISPR CTGTGAGATAAATGGATGAC TGG Intronic
901343968 1:8522289-8522311 CTGTAACATAAATGTCTGACAGG - Intronic
903990123 1:27261574-27261596 CTGTGAGATAAATGGATGACTGG + Intronic
905631679 1:39522286-39522308 TTGTCAAATAAATGAATGACAGG - Intronic
905666074 1:39763886-39763908 TTGTCAAATAAATGAATGACAGG + Exonic
910146840 1:84089858-84089880 CTGATGGATAAATGGATGAGAGG - Intronic
910566264 1:88646308-88646330 CTGTGGGAGATATGGATAACGGG + Intergenic
911941261 1:104050945-104050967 CTGGGAGAATAATTGATGACTGG - Intergenic
916199059 1:162252362-162252384 TTCTGAGATTAATGGATGATTGG + Intronic
916344434 1:163771932-163771954 CTGTGTGAAATATGGATTACAGG + Intergenic
916584818 1:166141275-166141297 CAGTGAGACAAATGGTTGAGAGG + Intronic
917964728 1:180171309-180171331 TTGTCAGCTAACTGGATGACGGG + Intronic
918096802 1:181342931-181342953 CTGTGTGACAAATGGGTGGCAGG + Intergenic
918352929 1:183676454-183676476 CTGTGATACATATGGATGAGTGG - Intronic
918615406 1:186538745-186538767 CTGTCAGATTAATGTATGAATGG - Intergenic
918691760 1:187489207-187489229 TTCTGAGATTAATGGATGTCTGG + Intergenic
922445818 1:225696332-225696354 CTGTGTGATAAATGAATAATGGG + Intergenic
1062859110 10:796122-796144 CTGGGAGATAACTGAATCACGGG + Intergenic
1062928337 10:1335193-1335215 CTGTGAGATGAATGGATGGATGG + Intronic
1063791094 10:9449099-9449121 CTGTGAACTCAATGGATGACTGG - Intergenic
1066528237 10:36306167-36306189 ATCTGAGGTAAATGGATTACAGG + Intergenic
1067482352 10:46611172-46611194 TTTTGAAATAAATGAATGACAGG - Intergenic
1067612397 10:47730492-47730514 TTTTGAAATAAATGAATGACAGG + Intergenic
1069250178 10:66257306-66257328 CTGTGAGAAAAATGGAGGACTGG - Intronic
1069827675 10:71263969-71263991 CTCTGAGCTAAATGGGTGGCAGG + Intronic
1071125377 10:82328690-82328712 CTGTGAGAATAAGAGATGACTGG - Intronic
1071310889 10:84342473-84342495 GTCTGAGAAAATTGGATGACAGG - Intronic
1071627818 10:87190739-87190761 TTTTGAAATAAATGAATGACAGG + Exonic
1071724279 10:88180769-88180791 CTGTTTGATATATGTATGACAGG - Intergenic
1073311972 10:102549433-102549455 GTGGGAGATAACTGGATCACAGG - Intronic
1074364511 10:112847122-112847144 AATTGAGAGAAATGGATGACAGG + Intergenic
1075140956 10:119835123-119835145 CTGAGAGGTAATTGTATGACAGG + Intronic
1075536794 10:123278276-123278298 CTGGGAGATAATTGAATCACAGG - Intergenic
1075976062 10:126696382-126696404 TTGTGAGATAATTGGATCAGGGG + Intergenic
1078093466 11:8282292-8282314 TTGAGAAATAAATGGATGAATGG + Intergenic
1078801505 11:14649443-14649465 CTGTGAGATATTTGGAAAACGGG + Intronic
1078923006 11:15848494-15848516 CTGTGAAAAAAATAGATGAATGG - Intergenic
1080433190 11:32217203-32217225 CTGTGAGATGTATGCCTGACTGG + Intergenic
1081436912 11:43036838-43036860 CTGTGTGAAAAATGGATGTAAGG + Intergenic
1083471465 11:62887059-62887081 CTGTGGAATAAATGAATAACTGG - Intronic
1084722440 11:70915910-70915932 CTCTGAAATAAATGGAGGTCAGG - Intronic
1089024542 11:115255535-115255557 CTGTGATATAAAAGAATGATTGG - Intronic
1089034905 11:115378404-115378426 CTGTCAGATAAGAGAATGACAGG + Intronic
1090700815 11:129294036-129294058 CGGTGAGATAAATTTAAGACAGG + Intergenic
1091070191 11:132555722-132555744 CAGTGAGCAAAATGGATGAAGGG - Intronic
1091584357 12:1807590-1807612 CTGGGAGATGAGTGGAAGACAGG - Intronic
1091820535 12:3472352-3472374 CTGTTTGATAAATGAATGAATGG + Intronic
1091972981 12:4803892-4803914 AGGGGAGAAAAATGGATGACCGG - Intronic
1092484729 12:8892794-8892816 CTGTTAGATAAATTGCTGAGAGG - Intergenic
1095611323 12:44132031-44132053 CTGAGCGATAAAAAGATGACTGG + Intronic
1098047700 12:66419052-66419074 CTGAGAGATAAATGGATAAAAGG + Intronic
1098407320 12:70140266-70140288 CTGTAAGGAAAATGGAGGACTGG + Intergenic
1098617749 12:72551590-72551612 ATGTGGAATAAATGAATGACTGG - Intronic
1100887467 12:99087247-99087269 CTATGCTATAAATGGATAACTGG + Intronic
1101070841 12:101074041-101074063 CTGTGAGGGAAATGGTAGACAGG + Intronic
1108443700 13:50484425-50484447 CTGTGAGATAGGTGGTGGACTGG - Intronic
1108740054 13:53327759-53327781 CTGTGAGACACATTGATGACAGG + Intergenic
1108773177 13:53730731-53730753 CTGGGAGATAAATGAATCATGGG - Intergenic
1108918955 13:55653860-55653882 CTGTTAGATAACTGAATGAGTGG + Intergenic
1110392825 13:74994892-74994914 TTGAGATATAAATTGATGACAGG - Intergenic
1112321922 13:98415684-98415706 CAGTGAGAAGAATGGATCACAGG + Intronic
1114836802 14:26212208-26212230 AAGTGAAATAAATGAATGACAGG + Intergenic
1116972908 14:51086294-51086316 CTGTGAGAAAACTGGAACACAGG - Intronic
1119450422 14:74704939-74704961 CTATGAGATAAATGGAATGCAGG - Intronic
1120235698 14:81888419-81888441 CAGGGAGGAAAATGGATGACAGG - Intergenic
1121857228 14:97281421-97281443 TTGAGAAATGAATGGATGACTGG - Intergenic
1122011121 14:98748904-98748926 ATGTTAGATAAATAGATGATAGG + Intergenic
1124164413 15:27311400-27311422 CTGGGAGATACCTGGAGGACGGG + Intronic
1126330669 15:47527479-47527501 CTGTGAAATTAATTGATGAAAGG + Intronic
1126465670 15:48959461-48959483 TTGTTAAATAAATGGATGAATGG + Intronic
1132290533 15:100699343-100699365 CTGTGAGATTACTGGATCAGAGG + Intergenic
1139104715 16:63814535-63814557 CAGTGATAGAAATGGGTGACTGG + Intergenic
1140057204 16:71535986-71536008 CTAGCAGATAAATAGATGACAGG + Intronic
1140142877 16:72275397-72275419 TTATGAGATTAATGGATGAAGGG - Intergenic
1141045986 16:80716509-80716531 ATGGATGATAAATGGATGACTGG + Intronic
1141468680 16:84223759-84223781 CTGTTAGCTAAATGAATGAGGGG - Intronic
1141877702 16:86837471-86837493 CTCTGACCTAAATGGTTGACTGG - Intergenic
1142778635 17:2162703-2162725 CTGATAGGTAGATGGATGACTGG - Intronic
1143752049 17:9035373-9035395 GTGTGATATAAATGTATCACAGG + Intronic
1145394401 17:22483319-22483341 CTGTGAGATGAATGGACAGCAGG - Intergenic
1148188295 17:45660560-45660582 CAGTGTGTTAAATGGCTGACAGG + Intergenic
1148213216 17:45820466-45820488 CTGTGAGCTGAATTGATGCCTGG - Intronic
1149402846 17:56316473-56316495 CTGTGAAATAAATGGAGAAAAGG + Intronic
1155510961 18:26576387-26576409 ATGTGTGTTAAATGGATGAATGG - Intronic
1155775573 18:29756468-29756490 GTATGAGATAAATGGATGTTTGG - Intergenic
1156446179 18:37238580-37238602 TAGGGAGAGAAATGGATGACTGG + Intergenic
1156585307 18:38425364-38425386 CTTTGAGATCATTGGCTGACAGG - Intergenic
1157728391 18:49983109-49983131 CTGAGAGATAAGTTGATAACTGG - Intronic
1159073597 18:63654886-63654908 CTCTGATATCAATGGATGAGAGG - Intronic
1160226764 18:77018089-77018111 TAGAGAGATAGATGGATGACTGG - Intronic
1164745538 19:30610042-30610064 CTGTGACATGGATGGATGAGTGG - Intronic
1164920416 19:32084938-32084960 ATGATAGATAAATGGATGAATGG + Intergenic
1164961312 19:32433184-32433206 CTGTGAAATAAAGGAATGAATGG - Intronic
1168079994 19:54003070-54003092 GTATGAGAAAAATGTATGACAGG + Intronic
926415348 2:12644107-12644129 ATGTGAGATAATTGGATGATGGG - Intergenic
927357864 2:22194249-22194271 TTGTGAGTTAAATGGAAGAATGG + Intergenic
927933900 2:27064121-27064143 CTGTGATTAAAATGGATGTCAGG - Intronic
928739551 2:34334041-34334063 ATGTGAAATAAATGCATGATGGG - Intergenic
930957300 2:57217816-57217838 CTGAGAGATGAAGAGATGACAGG + Intergenic
934055117 2:88244801-88244823 GTGTGAGATAATTGAATCACAGG + Intergenic
935120576 2:100180288-100180310 CTGAGTGATACATGGATGAATGG + Intergenic
935217457 2:100985584-100985606 CTGTTTGATAAATGAATGAATGG - Intronic
936056439 2:109265365-109265387 CTGTGAGGAGAATGGATAACAGG - Intronic
936678328 2:114740999-114741021 CTGTGGGATATGTGGATAACAGG + Intronic
938223080 2:129588158-129588180 CTGTGATGTAAGTGGAGGACTGG - Intergenic
938694651 2:133824349-133824371 CTATGAGATAGATGGACGCCAGG + Intergenic
938974023 2:136458529-136458551 GTGTGAGATAATTGGATCATGGG - Intergenic
939197269 2:138988561-138988583 CACTGAGAAAATTGGATGACTGG - Intergenic
940691991 2:156929848-156929870 CTCTGAGAAAAATTGTTGACTGG + Intergenic
941729744 2:168903498-168903520 AAGTGTGATAAATGGATGAATGG + Intronic
942775895 2:179582228-179582250 CTGTGAGATTAATAGATCAGGGG - Intronic
943256459 2:185599568-185599590 CACTGAGATAAATGCATGTCTGG - Intergenic
945802131 2:214447334-214447356 CTGAGAGATACATGGATGTCTGG - Intronic
947218068 2:227767612-227767634 CTGTGAGGAAAATGGATGTGGGG + Intergenic
948251030 2:236529241-236529263 GTGGGAGGTAAATGGATCACGGG - Intergenic
948719789 2:239892229-239892251 CAGAGAGAAAAATCGATGACGGG - Intergenic
1169694282 20:8369795-8369817 CTGTGAGATGAAGGGTGGACAGG - Intronic
1169785687 20:9357221-9357243 CTGTGAGAATAATCAATGACGGG - Intronic
1170662351 20:18354344-18354366 TTTTGAGATAAATGGATCTCTGG + Intergenic
1170732610 20:18987796-18987818 CTGTGAGCTAAATAAATGGCTGG - Intergenic
1170971003 20:21116526-21116548 CTGGGAGATGATTGGATCACAGG - Intergenic
1171141238 20:22745272-22745294 CAGTGAGATAAAATAATGACAGG - Intergenic
1172575829 20:36007888-36007910 ATAAGAGATAAATGGATGACTGG - Intronic
1174011501 20:47453476-47453498 CTGTGAGATAAATGTTTTATTGG - Intergenic
1176292077 21:5051405-5051427 ATGTGAGATGAATGAATGAGTGG - Intergenic
1176292104 21:5051728-5051750 ATGTGAGATGAATGGATGAGTGG - Intergenic
1176668341 21:9708406-9708428 CAGTAAGATAAATGGCTGACTGG - Intergenic
1178907869 21:36651215-36651237 CCGTGAGAGAGATGGATGAATGG - Intergenic
1179865153 21:44211922-44211944 ATGTGAGATGAATGGATGAGTGG + Intergenic
1179865180 21:44212241-44212263 ATGTGAGATGAATGAATGAGTGG + Intergenic
949688230 3:6602861-6602883 TTGTGTGATAAATGGAACACAGG + Intergenic
950139244 3:10603949-10603971 CTGAGAGATATATGTTTGACTGG + Intronic
950834543 3:15906429-15906451 CTGTAAGGAAAATGGAAGACTGG + Intergenic
952002437 3:28801997-28802019 CTTTGAGAGAAATGGATGGAGGG + Intergenic
954503967 3:51050638-51050660 CTGAGAGACAAATGGAGGGCAGG + Intronic
955474835 3:59326056-59326078 CTGTGAGGTAATTGGATCATGGG - Intergenic
955765231 3:62337118-62337140 CTGTGAGGTAAAGTGATGTCCGG - Intergenic
957104003 3:75862964-75862986 CTATGAAATAAATGGATAACAGG + Intergenic
957661562 3:83161818-83161840 CTGAGAGATAAATGGATCTCAGG + Intergenic
957955141 3:87176818-87176840 CTGTGAGAAGACTGGATGGCTGG + Intergenic
959052303 3:101535985-101536007 CCGTGAGGAAAATGGAGGACTGG + Intergenic
959853698 3:111122098-111122120 CTATAAAATAAATGCATGACAGG - Intronic
963941383 3:151099066-151099088 GTGGGAGATAAATGAATCACGGG - Intronic
965472021 3:169105638-169105660 CTATGACATTAATGGATCACAGG - Intronic
965935374 3:174103047-174103069 CTGTAAAATAAATGGAGGACTGG + Intronic
966268951 3:178081849-178081871 TTGTTGAATAAATGGATGACTGG + Intergenic
966679816 3:182629951-182629973 CTAGGAAATAAATGGAGGACTGG + Intergenic
970226067 4:13858083-13858105 CTGGGAGAGAAATGGATTACTGG + Intergenic
970499016 4:16657828-16657850 CACTGAGATAAATGGATGAATGG - Intronic
971834036 4:31738177-31738199 CTGTGGAATAAATGGATGGATGG + Intergenic
972037077 4:34538150-34538172 CTGTGACATAAATAGATAGCTGG - Intergenic
972817793 4:42663180-42663202 CCGTGAGACGAATGGAAGACAGG - Intergenic
974125233 4:57687935-57687957 CAGTGAGGTAAAGGGATGGCTGG + Intergenic
976055799 4:81064775-81064797 CTGTTTGATAAATGTTTGACTGG + Intergenic
977366120 4:96069532-96069554 CTGGGAGGTAAATGAATCACGGG - Intergenic
981158382 4:141467603-141467625 CTATGACATCACTGGATGACAGG + Intergenic
981644850 4:146987183-146987205 CTGTGACATAAAACTATGACAGG + Intergenic
982213453 4:153059779-153059801 GTGTGAGATGAAGTGATGACAGG - Intergenic
983472384 4:168173391-168173413 CTTTGAGTGAAATGGATGAGAGG + Intronic
985406440 4:189643105-189643127 CAGTAAGATAAATGGCTGATTGG + Intergenic
988300397 5:29417902-29417924 TCCTGAGATAAATGGAGGACTGG - Intergenic
988305661 5:29491287-29491309 CTGCGAGATAATTGAATTACAGG - Intergenic
993200115 5:84805069-84805091 TTCTGAGGTAAATGGATGACAGG + Intergenic
993510901 5:88770585-88770607 ATGGGAGAGAAATGGATGAAGGG - Intronic
994170298 5:96652509-96652531 CTGTGAGCTGATTGGATGAGTGG - Intronic
994665025 5:102695507-102695529 CGGTGAGGAAAATGGAGGACTGG - Intergenic
995097639 5:108257940-108257962 CTTTGAGATCAAGGTATGACTGG - Intronic
995634459 5:114170261-114170283 TTGTGAGGTAAATGAATGATTGG - Intergenic
997164645 5:131646908-131646930 CTTTCAGATTAGTGGATGACAGG + Intronic
997939230 5:138141611-138141633 CTGTGTGATAAACTGATGATTGG - Intronic
998792315 5:145778294-145778316 CTGAGAGATACAGGGACGACTGG + Intronic
999887136 5:155936462-155936484 CTGAGAGCTAAAAGGATGATGGG - Intronic
1002508579 5:179698229-179698251 CAGAGAGATACAGGGATGACAGG - Intronic
1003591052 6:7437181-7437203 CTATGAGATAAAGAAATGACAGG + Intergenic
1005885668 6:30095871-30095893 CTGGGAGAACAATGGATGTCCGG + Intergenic
1006747334 6:36352495-36352517 GTGGGAGATTAATGGTTGACTGG - Intergenic
1008135760 6:47774891-47774913 CTGGGAGATAAATAGAAGAATGG + Intergenic
1008263332 6:49393616-49393638 ATGTGAGTTAAATGGAAGAAAGG + Intergenic
1008560603 6:52720975-52720997 CTGGGAGATAACTGAATCACGGG + Intergenic
1008940141 6:57037938-57037960 CTGGGAGAAAACTGGATCACTGG + Intergenic
1009983455 6:70753777-70753799 CAGTGAGAAAAATGGATTAAAGG - Intronic
1010338562 6:74720517-74720539 AGGTGAAATAAAAGGATGACTGG - Intergenic
1010806611 6:80244556-80244578 CTGAGGGAAAAATGGATAACAGG + Intronic
1011624129 6:89269795-89269817 CGGGGAGATAAATGGATGAGGGG + Intronic
1014241599 6:119023781-119023803 TTGTGAGAAAAATCAATGACAGG - Intronic
1016104251 6:140142363-140142385 CTGGGAGATAAAGAGATGAGAGG - Intergenic
1017485639 6:154899779-154899801 CTGTAAGATTAATGCATGGCAGG - Intronic
1017810409 6:157980265-157980287 GAGAGAGATAAATGGAAGACTGG + Intergenic
1020897909 7:13965284-13965306 CTGTGAGAAAAATAGATGGGAGG - Intronic
1022880792 7:34585066-34585088 CTGAGAGACACAAGGATGACTGG + Intergenic
1023246650 7:38212075-38212097 CTGTGAGAAGAATGGATTGCAGG - Intronic
1023319071 7:38974479-38974501 CTGATAGATAAATGGAGGACTGG - Intergenic
1026516200 7:71074788-71074810 CTGTCAGATAAATAAATTACAGG + Intergenic
1027373648 7:77533160-77533182 CTCAGAGTTAAATGGATGAAGGG - Intergenic
1027462325 7:78470076-78470098 CAGTGAGAAAGATGCATGACTGG - Intronic
1031687107 7:124744561-124744583 TTATGAGATAACTGGATGAGTGG - Intergenic
1034068430 7:148159087-148159109 CTGTGAGATAAAAACATGAGAGG - Intronic
1035990351 8:4483075-4483097 GTGGGAGATAATTGAATGACAGG + Intronic
1037728562 8:21504630-21504652 CTGTGACAGCAATGGATGAGAGG - Intergenic
1038034286 8:23674075-23674097 GTGAGAGACAAATGGATGCCAGG - Intergenic
1039118220 8:34116159-34116181 CTGTGAGATAAAAGAATCATGGG + Intergenic
1041956425 8:63561618-63561640 GAATGAGGTAAATGGATGACTGG - Intergenic
1044910298 8:97051006-97051028 CAGTGAGATTAATGGTTGCCAGG + Intronic
1046186985 8:110734467-110734489 ATGTGAGATACATGGACAACTGG + Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1049342657 8:142121467-142121489 GCGTGAGATAAATTAATGACGGG - Intergenic
1051786027 9:20744603-20744625 CTTTAAAATATATGGATGACTGG + Intronic
1053275870 9:36782928-36782950 CTTGGAGAGAAATGGTTGACAGG + Intergenic
1053294353 9:36902346-36902368 ATGTGAGTGAAATTGATGACTGG - Intronic
1058527251 9:105872174-105872196 CTATGTGTTAAATGTATGACAGG - Intergenic
1058905683 9:109480885-109480907 CTGTGGGATGAATGGATGGATGG + Intronic
1059289722 9:113212077-113212099 CTGTTAGATGAAAGGATGGCAGG - Intronic
1060031565 9:120218816-120218838 GTGGGAGATACATGGATGAGGGG - Intergenic
1203653008 Un_KI270751v1:146482-146504 CTATGAAATAAATGGATAACAGG + Intergenic
1203657525 Un_KI270753v1:12549-12571 CAGTAAGATAAATGGCTGACTGG + Intergenic
1189183049 X:39021275-39021297 CTTTTAAATAAATGGAGGACAGG - Intergenic
1190678628 X:52804877-52804899 CTGTGAGAGAACTGGCTGACTGG - Intergenic
1196556744 X:117096041-117096063 TTGTGAGATGACTAGATGACTGG + Intergenic
1197981646 X:132223637-132223659 CTGTGTGATAAATGAATGAGTGG - Intergenic