ID: 903994138

View in Genome Browser
Species Human (GRCh38)
Location 1:27294788-27294810
Sequence CTGAGCTAGGACATCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903994138_903994141 29 Left 903994138 1:27294788-27294810 CCCAGAGAGATGTCCTAGCTCAG 0: 1
1: 0
2: 2
3: 7
4: 129
Right 903994141 1:27294840-27294862 TAGATAGAAATATGATAGTATGG 0: 1
1: 0
2: 4
3: 31
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903994138 Original CRISPR CTGAGCTAGGACATCTCTCT GGG (reversed) Intronic
902414686 1:16231829-16231851 CTGAGCTCGAACATCTCCCGTGG - Exonic
903994138 1:27294788-27294810 CTGAGCTAGGACATCTCTCTGGG - Intronic
906349683 1:45047613-45047635 TTTATCTAGGACATCACTCTAGG - Intronic
907472706 1:54684699-54684721 CAGAGCTAAGACAAGTCTCTTGG - Intronic
910433290 1:87179765-87179787 ATGAGCCAGGACACCTTTCTTGG + Intergenic
910673910 1:89798819-89798841 CTGAGCTAGTAATTCACTCTGGG - Intronic
911728668 1:101268996-101269018 CTCAGCTAGTACCACTCTCTAGG + Intergenic
912112176 1:106356983-106357005 CTGAGCTAGGGCATAACTCATGG + Intergenic
912282231 1:108327903-108327925 ATGACCTGGGAGATCTCTCTTGG + Intergenic
915535652 1:156533910-156533932 CTGAGCCAGGTCTTCCCTCTGGG + Intronic
919065857 1:192692346-192692368 CTGAGCTAGCACATATTTGTTGG - Intergenic
920714846 1:208330208-208330230 GTGAGCTAAGAAATCTCTCCCGG + Intergenic
922398716 1:225228568-225228590 ATGTGCAAGGACATCTCTCCTGG + Intronic
1065811856 10:29450196-29450218 CTGCGCTAGCACTTCTATCTTGG - Intergenic
1067785366 10:49241906-49241928 CTGAGAAAGGGCCTCTCTCTAGG - Intergenic
1070968947 10:80548000-80548022 AGGTGATAGGACATCTCTCTGGG - Intronic
1072251257 10:93584015-93584037 CTGAGTAAGGATATCGCTCTAGG - Intronic
1076564709 10:131390236-131390258 CTGAGCCCTGAGATCTCTCTAGG + Intergenic
1076921721 10:133457772-133457794 CTGAGCCAGGACACCTCTGTGGG - Intergenic
1079895321 11:26112458-26112480 CTGAGCAAGGCCATGTCCCTAGG + Intergenic
1085172716 11:74462770-74462792 CTGAGCTGGGACAACTCCCCTGG - Intronic
1085885900 11:80521403-80521425 CTGAGATAGAACATCACTGTTGG - Intergenic
1087153310 11:94877888-94877910 CTGAGCTCTGACCTTTCTCTTGG + Intergenic
1089260707 11:117222081-117222103 CTGAGTCGGGAGATCTCTCTGGG - Intronic
1089697913 11:120227158-120227180 CTGCGCCAGTACATCTCTGTAGG - Intronic
1090309124 11:125719349-125719371 CTGCCCTAGGACATTGCTCTAGG - Intergenic
1090886242 11:130879395-130879417 ATGTGCTAGGAAATCACTCTTGG - Intronic
1091398364 12:168279-168301 CAGTGCTAGGACATCTGTCTAGG - Intronic
1099230579 12:80019294-80019316 CAGAGCCAGGAGATCTCTATTGG + Intergenic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1105280683 13:18960933-18960955 CAGAGCTATGACAGCTCCCTGGG + Intergenic
1106104114 13:26718891-26718913 CTTGGCTAAGACATCTCTCATGG - Intergenic
1110024247 13:70513642-70513664 CTGAACTCGAACTTCTCTCTAGG - Intergenic
1111914877 13:94350501-94350523 CTGACCCCAGACATCTCTCTTGG + Intronic
1119612430 14:76074892-76074914 CTAAGCTGTGACAGCTCTCTTGG - Intronic
1120219744 14:81718860-81718882 CTGGGCTTGGACATCCCTATAGG + Intergenic
1127290778 15:57569167-57569189 CTGAGCTAGTTCATGTCTCAAGG - Intergenic
1127380870 15:58429560-58429582 CTGAGCAAGGACTTCTGCCTTGG - Intronic
1128280280 15:66388262-66388284 CTGAGCTCCCACAACTCTCTTGG + Intronic
1129697550 15:77749232-77749254 CTGGGCTCAGACCTCTCTCTAGG - Intronic
1130940474 15:88504182-88504204 CTCAGCAAGGAGATCTCTCCAGG + Intergenic
1133756277 16:8764744-8764766 ATGAGCTGGGACATCCCTTTGGG - Exonic
1134338577 16:13324320-13324342 CTGAGCCAGGACCTAGCTCTGGG + Intergenic
1139771885 16:69284223-69284245 CTGATCAAGGAAGTCTCTCTAGG + Exonic
1140572474 16:76124458-76124480 CTGGGCTTGGACATCGGTCTAGG - Intergenic
1143611664 17:8021267-8021289 CTGAGCTGGGATACCTCACTGGG + Intergenic
1146811366 17:35906514-35906536 CTGAGCTGGGGCATCTTGCTGGG + Intergenic
1149262785 17:54897798-54897820 CTGTGCTATGTCATCCCTCTTGG - Intergenic
1151769001 17:76147451-76147473 CAGAGTCAGGACAGCTCTCTGGG - Intronic
1153218326 18:2840671-2840693 CTAAGCTATTACAGCTCTCTTGG + Intergenic
1153410095 18:4783168-4783190 CTGAGTTATCCCATCTCTCTAGG + Intergenic
1157269069 18:46256257-46256279 CTGTGCTAAGACATATCACTTGG + Intronic
1158816727 18:61107587-61107609 CCAAGCTAGGAGATCTCACTGGG + Intergenic
1160076804 18:75685067-75685089 CAGGGCTAGCACTTCTCTCTGGG + Intergenic
1161075935 19:2285814-2285836 CGGAGCTAGGACAGCACTCGGGG - Intronic
1162472596 19:10881446-10881468 CAGGGCCAGGACATCTCTCCAGG + Intronic
1164536344 19:29088803-29088825 CTGAGCTAAGATATGTCTTTGGG - Intergenic
1167412464 19:49353028-49353050 CTCAGGTAGGAGATCTTTCTGGG - Intronic
926933072 2:18060107-18060129 CTGACCTATCACATCTCTCCAGG + Intronic
927720490 2:25378966-25378988 CTGAGCAAGGCCACCTCCCTGGG - Intronic
929022724 2:37569393-37569415 GGGAGAGAGGACATCTCTCTGGG + Intergenic
930269763 2:49242191-49242213 CTGAGCTGTGACATCACTTTTGG - Intergenic
932275799 2:70451362-70451384 CTTAGCCTGGACATGTCTCTAGG + Intronic
932642120 2:73459725-73459747 CTGAGCTAGGAAGACACTCTAGG + Intronic
933944731 2:87276175-87276197 CTGACCTCGAACTTCTCTCTAGG + Intergenic
936335480 2:111585404-111585426 CTGACCTCGAACTTCTCTCTAGG - Intergenic
937481973 2:122271217-122271239 GTGAAATAGGACATCTTTCTAGG - Intergenic
937581256 2:123491462-123491484 ATCAGCTAAGACAGCTCTCTGGG + Intergenic
941499905 2:166261273-166261295 CTGAGGCAGGACATTTATCTGGG - Intronic
943724900 2:191243640-191243662 CTCAGCTAGGTTTTCTCTCTAGG + Intergenic
943778265 2:191792105-191792127 CTAAGCAGGGACATTTCTCTTGG + Intergenic
947279529 2:228434451-228434473 CTGAGCTTGGACATCCTTTTCGG + Intergenic
1169874645 20:10283715-10283737 CTAAGCTAGGACCTCTCTCATGG - Intronic
1173850232 20:46213173-46213195 CTGAACTGGTACATCTCTGTGGG + Exonic
1178599806 21:33985804-33985826 GTGAGGCAGGACATCTCTGTAGG - Intergenic
1182843203 22:33409044-33409066 CTGAGATAGGCTATTTCTCTTGG + Intronic
1183406754 22:37633926-37633948 CTGGGCTTGGACTTCCCTCTGGG - Intergenic
1183609050 22:38884850-38884872 TGGAGATAGGACATCCCTCTGGG + Intergenic
951045742 3:18036277-18036299 CTGTGTTAGGACATGGCTCTTGG + Intronic
952047538 3:29341589-29341611 CTGAGCTTGCTCATTTCTCTGGG + Intronic
955218328 3:57003466-57003488 CTGAGCTAGGACCTGACTCCAGG + Intronic
957984088 3:87550415-87550437 CTGGGCTAGGAATTTTCTCTTGG + Intergenic
961432920 3:126895974-126895996 CTGAGCTAGAACATCTCTCAGGG - Intronic
961578032 3:127854480-127854502 CTGTGCTGGGTCATCTCACTGGG - Intergenic
964514997 3:157498202-157498224 CTGAGCTGGGACATGACCCTTGG - Intronic
966632957 3:182098796-182098818 CTGAGCAAAATCATCTCTCTGGG - Intergenic
967223894 3:187273262-187273284 CTGGGCTGGGAGGTCTCTCTAGG - Intronic
967269666 3:187722642-187722664 TTGAGCAATGACATCTTTCTTGG - Intronic
969686712 4:8679551-8679573 CTGAGCTAGGATTTCTGTCCTGG + Intergenic
970317491 4:14843492-14843514 CTAAGGTAGAACATCTTTCTTGG - Intergenic
973662693 4:53124127-53124149 GTGAGCTAGGACATCCCACAGGG + Intronic
978707697 4:111734844-111734866 CTGATGTAAGCCATCTCTCTAGG + Intergenic
980014030 4:127628363-127628385 CTGAGGTAGGAGATGTGTCTAGG + Intronic
980972706 4:139581746-139581768 CTGTGCTGGGGGATCTCTCTAGG + Intronic
983884485 4:172965140-172965162 CTATGCTAAGTCATCTCTCTGGG + Intronic
987266527 5:16262059-16262081 CTGGGCTAGGACACTTTTCTGGG - Intergenic
988738080 5:34042844-34042866 CTGGGCTAGGTCATCTACCTCGG + Exonic
991425254 5:66484428-66484450 CTGAGCACGGACATAGCTCTGGG + Intergenic
994864087 5:105242509-105242531 CTGAGATATGACATTTATCTTGG + Intergenic
995863943 5:116671136-116671158 TTGAGCTTGGACTTTTCTCTGGG + Intergenic
999279673 5:150357019-150357041 CTCAGCTTAGATATCTCTCTGGG + Intergenic
1000335797 5:160240429-160240451 CTGAGCTGTGACATCTGTCCAGG - Intergenic
1000546947 5:162614845-162614867 CTGATGTAGGACATTTTTCTGGG - Intergenic
1002105041 5:176875836-176875858 CTCAGCTGGGACTTCTCTTTTGG + Intronic
1010009384 6:71032624-71032646 CTAAGCTAGGGCATCTCACTCGG + Intergenic
1010555775 6:77277483-77277505 CTGAGCTACTAGATCTTTCTTGG - Intergenic
1013162759 6:107561540-107561562 CTGGGCTGGGCCATTTCTCTGGG + Intronic
1016640948 6:146348758-146348780 CTGGTTTAGGACTTCTCTCTGGG - Intronic
1020054318 7:5106654-5106676 CTGAGCTGGGACCTGTCCCTAGG - Intergenic
1021661344 7:22921147-22921169 ATGAGCTAACACATTTCTCTTGG + Intergenic
1021816876 7:24455713-24455735 CTGTGCCAGGACATTTTTCTAGG - Intergenic
1026096415 7:67349902-67349924 GTGAGGTATGACATCTCACTTGG + Intergenic
1027219137 7:76202700-76202722 CTGGGCTAGAAACTCTCTCTGGG - Intronic
1029699368 7:102236340-102236362 CTGAGGTAGGCCATGCCTCTTGG + Intronic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1033843925 7:145409077-145409099 GTCATCTTGGACATCTCTCTGGG - Intergenic
1036392820 8:8339371-8339393 CTGAGCAAGGACTACTGTCTTGG - Intronic
1039589834 8:38737061-38737083 CTGAGCTAGGTCATTTCTTAGGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG + Intergenic
1044580953 8:93825809-93825831 CTGAGAGAGGTTATCTCTCTTGG + Intergenic
1045246422 8:100445390-100445412 CACACCTGGGACATCTCTCTAGG + Intergenic
1045970669 8:108076462-108076484 CTGAGCTAGGAAATATCTTTGGG + Intronic
1047003035 8:120592196-120592218 CAGAGCTAGGCCCTCTCTCTTGG - Intronic
1048133376 8:131721579-131721601 CAGAGCCAGGACATCTCATTTGG + Intergenic
1049142675 8:140970374-140970396 CTGAGCTTTGAAATGTCTCTTGG - Intronic
1049419990 8:142512165-142512187 TTGAGCAAGGCCCTCTCTCTGGG - Intronic
1051395195 9:16612890-16612912 CTGAGCTAGGAGATATGTGTGGG - Intronic
1052046630 9:23801544-23801566 CTTAGCTAGGACACTTCTGTTGG - Intronic
1055782685 9:79836386-79836408 TTCAGCTCAGACATCTCTCTAGG - Intergenic
1056311830 9:85348722-85348744 CTGGGCTATGACATCTTTCCAGG - Intergenic
1056786427 9:89595483-89595505 CTGAGCTGGGTCATCTGTCATGG + Intergenic
1056932203 9:90888584-90888606 ATGAGATCGTACATCTCTCTTGG - Exonic
1059650671 9:116313222-116313244 CTCAGCAGGGACATCTCTCATGG - Intronic
1062118846 9:134823114-134823136 CTGAGCTAGGACGGTTGTCTGGG - Intronic
1062358312 9:136175482-136175504 CTCAGCTGGGGCAGCTCTCTGGG + Intergenic
1188513682 X:30962818-30962840 CTGGGCTATGTCAGCTCTCTTGG - Intronic
1195017254 X:100791731-100791753 CTGAGCTAGGACATTTCACAAGG + Intergenic
1196395657 X:115259295-115259317 ATGAGCTAGAAAACCTCTCTTGG - Intergenic