ID: 903994443

View in Genome Browser
Species Human (GRCh38)
Location 1:27296959-27296981
Sequence GACCCCGTGATGGAAGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903994439_903994443 -5 Left 903994439 1:27296941-27296963 CCCACGATGGAACCATCAGACCC 0: 1
1: 0
2: 1
3: 0
4: 57
Right 903994443 1:27296959-27296981 GACCCCGTGATGGAAGCTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 51
903994440_903994443 -6 Left 903994440 1:27296942-27296964 CCACGATGGAACCATCAGACCCC 0: 1
1: 0
2: 1
3: 5
4: 129
Right 903994443 1:27296959-27296981 GACCCCGTGATGGAAGCTAGAGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903994443 Original CRISPR GACCCCGTGATGGAAGCTAG AGG Intronic
902795155 1:18796088-18796110 GACCCCGTGATGGATGTCAGAGG - Intergenic
902803506 1:18846257-18846279 CACCAGGTGATGGGAGCTAGTGG + Intronic
903994443 1:27296959-27296981 GACCCCGTGATGGAAGCTAGAGG + Intronic
905913803 1:41671572-41671594 GACTCCAAGATGGAAGCTATAGG - Intronic
907507155 1:54927910-54927932 GACCCTGTGCTGGGAACTAGGGG + Intergenic
916242717 1:162656201-162656223 GACCCTGTGCTAGATGCTAGAGG - Intronic
1064704670 10:18059492-18059514 CACCCCGTGATGGAAATGAGGGG + Intergenic
1071568811 10:86685321-86685343 GACCCCAGAGTGGAAGCTAGGGG - Intronic
1074912846 10:117927441-117927463 GACCCTGTGATGGAAGCTGTGGG + Intergenic
1083751029 11:64760604-64760626 GGCCCCGTGCTGCAGGCTAGCGG - Intergenic
1086198709 11:84173850-84173872 GACCCTGTGATGGAAGGAAAGGG - Intronic
1089185353 11:116611117-116611139 GACCCAGTGATGGAAGGTCTTGG + Intergenic
1090502499 11:127275322-127275344 CAGCCCATGATGGCAGCTAGAGG + Intergenic
1103160788 12:118727518-118727540 AACACTGTGATGGAAGCTGGGGG - Intergenic
1108121566 13:47193602-47193624 GATCCCATGTTGAAAGCTAGAGG + Intergenic
1108443896 13:50486746-50486768 GACCTTGTGATGGATGCTTGAGG - Intronic
1112751980 13:102592425-102592447 CAGCCCGTGATGGAAGCGAAGGG - Intergenic
1128733658 15:70037358-70037380 GACCCAGTGTTGGAGGCTAGGGG - Intergenic
1128791048 15:70434203-70434225 GAGCCAGTGAGGGAAGGTAGAGG + Intergenic
1129509191 15:76108126-76108148 GACCCTGAGATAGAAGCTGGGGG - Intronic
1132351597 15:101142814-101142836 GACCCCCTGAGGGAGGCTTGTGG + Intergenic
1132808692 16:1787537-1787559 GAGCCTGTGATGGAGGCTGGTGG + Intronic
1136103240 16:28010696-28010718 GTCTCCGTGATGGAAGCCAGGGG + Intronic
1138361112 16:56427957-56427979 GAGTCCATGATGAAAGCTAGAGG + Intergenic
1139849334 16:69941163-69941185 GTCCCCGTGTTGGAGGCTGGCGG - Exonic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1152217940 17:79045280-79045302 GACCCAGTGCTGGAGGCTGGAGG + Intronic
1160983506 19:1827309-1827331 GGCCCCGTCGGGGAAGCTAGTGG - Exonic
929537474 2:42792652-42792674 GACCCCGTGGTGGGGGCTTGGGG + Intergenic
945017840 2:205538269-205538291 GACCTGGTGATGGAAGAGAGGGG + Intronic
945288096 2:208102545-208102567 GACCCAGTGATGGTAACGAGGGG - Intergenic
1170072414 20:12382804-12382826 GACCCCATGAAGCAGGCTAGAGG + Intergenic
1178916306 21:36707422-36707444 GCCCCCGTGGTGGAGGCTGGGGG + Intronic
1180197752 21:46207750-46207772 GTCCCTGTGCTGGAAGCTGGAGG - Intronic
953385462 3:42503371-42503393 GACCCCAAGGTGGAAGCTGGTGG + Intronic
954379708 3:50213064-50213086 GACCCAGTGATGGGAGAGAGGGG + Intronic
954610885 3:51943953-51943975 GACCCTGTCTTGGAAGCTTGGGG - Intronic
959337781 3:105088021-105088043 TATCCTGTGATGGAAGCCAGTGG - Intergenic
967704247 3:192631326-192631348 GATGTCGTGATGGATGCTAGAGG - Intronic
986840815 5:11695103-11695125 TAGACCCTGATGGAAGCTAGTGG - Intronic
990363316 5:55043608-55043630 GACCCCATGAAGGAAGTTATGGG - Intergenic
992379781 5:76225913-76225935 GGCCCCATGCTGGAAGCCAGAGG + Intronic
1006114028 6:31765852-31765874 CACCCTGTGATGGAAAGTAGTGG + Intronic
1007732129 6:43953812-43953834 CACCCCATGATGGGAGCTAAAGG - Intergenic
1018972485 6:168538600-168538622 GACCCCCTGCTGGAATCTGGGGG + Intronic
1024604375 7:51012327-51012349 GACCCTGTGATGAGTGCTAGGGG - Intergenic
1024992934 7:55250645-55250667 GACCCTGTGCTGGAGGCTACTGG - Intronic
1029335637 7:99897137-99897159 GACCCCGTGAAGAGATCTAGTGG + Intronic
1031971146 7:128065966-128065988 AAACCCGTGCTGGAAGCTGGAGG - Intronic
1032197868 7:129799678-129799700 GACCCAGGGCTGGAAGCTGGGGG - Intergenic
1048101520 8:131357542-131357564 GACCCCATGCTGGAAGGTTGTGG + Intergenic
1186505330 X:10086944-10086966 GACCCTGTGATGGCTACTAGCGG - Intronic
1188379046 X:29468861-29468883 GAACCCCTGATGGAAGCTTAGGG - Intronic
1189064022 X:37786850-37786872 GACCACGTGATTAAAGATAGAGG - Intronic
1190153508 X:47967913-47967935 GACCTCATGATGGAAGGTAAAGG - Intronic
1193092674 X:77511024-77511046 GTCCCCGTGAAGGGAGCCAGAGG + Intronic