ID: 903994846

View in Genome Browser
Species Human (GRCh38)
Location 1:27299370-27299392
Sequence CTGTGGGCATCAAGAAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903994846 Original CRISPR CTGTGGGCATCAAGAAAAGT TGG Intronic
900925687 1:5704898-5704920 CTGTGGGCTCCAAGAAAAACAGG + Intergenic
902971470 1:20055463-20055485 CAGTGGGCAGTAAGAAAAGCTGG - Intronic
903994846 1:27299370-27299392 CTGTGGGCATCAAGAAAAGTTGG + Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
906562544 1:46769679-46769701 GTGTGGGCATCAGAAAATGTGGG - Intronic
907706303 1:56835459-56835481 CTGTGGGCATCTAAAAAACAAGG - Intergenic
912134254 1:106640110-106640132 CTATGTGCTTCAAGAAAGGTAGG + Intergenic
912156650 1:106929472-106929494 GTTTGGGCATAAAGAAAATTGGG - Intergenic
915325406 1:155079215-155079237 CTGTGGGCGTCTAGGAAACTCGG + Intronic
915676171 1:157534321-157534343 CTCCGTGCATCAAGAAAAATTGG + Intronic
915686054 1:157636008-157636030 CTCTGTGCATCAAGAAAAATTGG + Intergenic
918811061 1:189121290-189121312 CTTTGGGCATCAGGAAACCTGGG + Intergenic
918844319 1:189589283-189589305 ATGAGGGCATAAAGAAAACTAGG - Intergenic
919778414 1:201208359-201208381 CTGAGGGCAGGAAGCAAAGTGGG + Exonic
921512140 1:216045038-216045060 CTGTGAGCACCAAGAGAAGAGGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
1069204936 10:65669579-65669601 CTTTGGGCATAAAGAAACTTTGG + Intergenic
1070536647 10:77383341-77383363 CTGGGGGCTTCTAGAAATGTGGG + Intronic
1070641140 10:78170907-78170929 CTGTGTGGCTCAAGACAAGTTGG + Intergenic
1073481924 10:103791491-103791513 CTGTGGACATCAAGAGAGCTGGG - Intronic
1075557621 10:123444822-123444844 CTGTGGGTAACAACAAATGTGGG - Intergenic
1076649524 10:131978411-131978433 CTTTGGGCACCTAGAAAAGCTGG - Intronic
1077371662 11:2185110-2185132 CTGTGGTCATCAAGAAGGCTTGG + Intergenic
1078552464 11:12290055-12290077 CAGTGGGCATCAGGAAGGGTAGG + Intronic
1078815649 11:14819710-14819732 CTGAGGGCAGCTAGAAAAGGTGG + Intronic
1078913082 11:15751455-15751477 CTGGGGGCATGTAGAAAGGTTGG - Intergenic
1079720450 11:23805293-23805315 CTGTGGGCATCCACTCAAGTTGG - Intergenic
1080754970 11:35188497-35188519 CTGTGGGCATCAAAGAAACAGGG - Intronic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1087959527 11:104331275-104331297 CTGAGGGCAACCAGAAAACTGGG - Intergenic
1090732395 11:129583091-129583113 CTCTGGGCAGCAAGAGAGGTGGG - Intergenic
1091761805 12:3092529-3092551 CTGAAGGCAGCAAGACAAGTAGG + Intronic
1093242044 12:16688746-16688768 CTGGGGGCACCAATAAAAGGAGG + Intergenic
1094577135 12:31696956-31696978 ATGTGGCTATCAAGAAAAATAGG + Intronic
1095203297 12:39410721-39410743 CTGTGGGCAGCAAAAAAACTTGG - Intronic
1100023715 12:90102119-90102141 CTGTGAGCATTAAGAAAAAATGG + Intergenic
1100373955 12:93994958-93994980 CTGTGTGGATCAACAAAAGCTGG - Intergenic
1105074496 12:133263820-133263842 CTGTCGACATCAAGAAGAGAAGG - Intergenic
1106763103 13:32887038-32887060 CTGTGGTCATTGAGAAATGTGGG + Intergenic
1110889721 13:80683649-80683671 AACTGGGCTTCAAGAAAAGTCGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1115862752 14:37707160-37707182 CTGTAAGCATCAAGATGAGTAGG - Intronic
1116461444 14:45179933-45179955 GTGAGGGCTTAAAGAAAAGTAGG - Intronic
1117077189 14:52116461-52116483 CTGTTGGCTTCGTGAAAAGTGGG - Intergenic
1117327168 14:54679987-54680009 GTGTGTGCATCAAGAAAAGATGG + Intronic
1118282276 14:64440513-64440535 CTGTGGGCATCTCTAAAAGTGGG + Intronic
1120018242 14:79498582-79498604 CTGTGGGCATGAGGAAAGGGAGG - Intronic
1121057106 14:90865694-90865716 CAGTGGGCAGCAGGAAAAGCTGG + Exonic
1122498864 14:102180596-102180618 CTGTGGGCAACAAGAAAAGTGGG + Intronic
1124881492 15:33646792-33646814 TTGTGGGCAGCAAGGAAGGTAGG - Intronic
1126196740 15:45939670-45939692 CTGTGGAAGTCAAGAAAACTTGG + Intergenic
1127809158 15:62548459-62548481 CTGTGTGCAACTTGAAAAGTAGG - Intronic
1128453071 15:67818319-67818341 CTGTGGCCAGCAAGTCAAGTGGG + Intergenic
1129696176 15:77741727-77741749 CTGTGGGCATCAGGTACAGTTGG + Intronic
1129999706 15:80035926-80035948 AGGTGGGCCCCAAGAAAAGTTGG - Intergenic
1130704849 15:86223536-86223558 CTGTGGGATTCAACAACAGTGGG + Intronic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1132374656 15:101321074-101321096 CTGGGGGCATCAGGAAGAGGAGG - Intronic
1133501142 16:6367913-6367935 CTGTGGGCAAAAAGTTAAGTTGG - Intronic
1139733713 16:68969583-68969605 CTGTGGGAAGCAAGGAAACTGGG + Intronic
1140281805 16:73561848-73561870 CTGTGGGCATCAGGATGACTGGG + Intergenic
1140980017 16:80099104-80099126 CTGAGGGCCTCACCAAAAGTAGG + Intergenic
1146135787 17:30319752-30319774 CTGTGGGCCTCAAAAGCAGTGGG + Intronic
1147355559 17:39893290-39893312 CTGTCGGCATAAAAAAAACTGGG + Intergenic
1148130028 17:45256955-45256977 CTGAGGGCATAAACAGAAGTGGG + Intronic
1148137113 17:45300645-45300667 CTGTGGGCAGGCAGAAAAGGAGG - Intronic
1149389610 17:56175791-56175813 CTGTTGGCATAAAGAAAGGCTGG - Intronic
1151153095 17:72104743-72104765 CTGTGGGCCTGAAGGAATGTTGG - Intergenic
1152640260 17:81446385-81446407 CTGTGGGTAACCAGAAAAGGGGG - Intronic
1203171861 17_GL000205v2_random:155739-155761 CTGTGTGTAGCAAGAAAAGATGG - Intergenic
1155108955 18:22695090-22695112 CAGTGGTTATTAAGAAAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156512996 18:37657004-37657026 CTGTGTGTATCAAAGAAAGTTGG - Intergenic
1158563135 18:58532255-58532277 CTGTGATCCTAAAGAAAAGTGGG + Intronic
1166920293 19:46224630-46224652 CTCTGGGCAAGAAGAAAGGTGGG + Intergenic
1167529946 19:50008980-50009002 CTGAGGGCACCAGGAACAGTAGG + Intronic
926203322 2:10816968-10816990 ATGTGGGCATCAAGGAACTTGGG - Intronic
926224462 2:10957166-10957188 CTGTGGCCATCAATCACAGTGGG + Intergenic
927650947 2:24913423-24913445 TTGGGGGCAGCCAGAAAAGTAGG + Intronic
928225455 2:29444379-29444401 CACTGGGCATCATGAAATGTTGG + Intronic
929459721 2:42094035-42094057 CTGCGGGTATCAGGAGAAGTGGG + Intergenic
929503943 2:42513696-42513718 CTCTGGGCTTCAGGACAAGTGGG - Intronic
930926694 2:56826832-56826854 ATGTGGGCATGGAGAAATGTTGG + Intergenic
931644295 2:64407686-64407708 ATTTGGCCATGAAGAAAAGTGGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
934222355 2:90096675-90096697 CTGTGGGTAGCAAACAAAGTAGG + Intergenic
935305008 2:101728945-101728967 CTGTTGACATGAAGAAAAATTGG + Intronic
935513858 2:104009267-104009289 CTCAGGACATAAAGAAAAGTTGG - Intergenic
941081475 2:161065931-161065953 CTGAGGTCTTGAAGAAAAGTTGG - Intergenic
943561171 2:189464400-189464422 CTGTGGGGAACAAGAAAAGTGGG - Intronic
944897402 2:204178845-204178867 CTGTGTGCAGCAGGAGAAGTAGG + Intergenic
947921421 2:233878174-233878196 CTGTGAGCAACAAATAAAGTTGG - Intergenic
1169182836 20:3585142-3585164 CTGTGGGTTTCTAGAACAGTTGG + Intronic
1170687642 20:18583994-18584016 CTGTCCACACCAAGAAAAGTAGG - Intronic
1171346922 20:24472187-24472209 CTGTACGCCTCAAGTAAAGTTGG - Intronic
1172493399 20:35359958-35359980 CTGTGGGCAAACAGACAAGTTGG + Intronic
1173759136 20:45544622-45544644 CTGAGGGGATGAAGAAGAGTAGG - Intronic
1179288517 21:39998117-39998139 CCCTGGGCACCAAGACAAGTAGG - Intergenic
1180647193 22:17348913-17348935 CAGAGGGCATGAAGAAAAGGAGG - Intergenic
1181362855 22:22352254-22352276 GGGTGGGCATCATGAAAAATGGG - Intergenic
1182264991 22:29107556-29107578 CTTTGGCTATCAACAAAAGTTGG - Intronic
1183387158 22:37521397-37521419 CTGTGGGCATCAAGCCAGGCAGG + Intergenic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1184416664 22:44355855-44355877 CTGTGGGCAGCAATGCAAGTGGG - Intergenic
949856169 3:8463420-8463442 GTATGGGCAGCAAAAAAAGTGGG - Intergenic
949898034 3:8784851-8784873 CTGTTAGCATCAAGAGAAGCGGG + Intronic
949944486 3:9179114-9179136 CTGTGTGCATCAAGAAGAGATGG - Intronic
950575875 3:13831819-13831841 CCCTGGGCATCGAGAGAAGTTGG - Intronic
950615938 3:14158256-14158278 CTGTGAGCAGGAGGAAAAGTGGG - Exonic
951491547 3:23275101-23275123 ATGTGGGCATCAACAATGGTTGG - Intronic
953374375 3:42416568-42416590 CTGAGGGCTTAAAGAAAGGTGGG - Intergenic
953543073 3:43839848-43839870 CTGTGGGCATCAATGTCAGTAGG + Intergenic
955078169 3:55633343-55633365 CTGTGGGCTTTAAGAACACTAGG + Intronic
956045218 3:65189014-65189036 CTGTGGACTACAAGAAAAATAGG - Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
957405510 3:79770685-79770707 CTGTGAACATCTATAAAAGTTGG + Intergenic
957593540 3:82230834-82230856 CTGTGAGCATCAATATAACTGGG - Intergenic
957912015 3:86631701-86631723 TTGTGGGAATCAACAAAACTTGG - Intergenic
958684015 3:97369372-97369394 CAGTGGACATATAGAAAAGTGGG + Intronic
960215076 3:115024108-115024130 CTGTTGGCAGAAAGCAAAGTTGG + Intronic
961591830 3:127986963-127986985 CTGTGGGAGGCAAGATAAGTGGG + Exonic
961681374 3:128602571-128602593 CTGAGGGTATCAACAAGAGTTGG - Intergenic
962799239 3:138875896-138875918 CTGTGGCCAGGAGGAAAAGTGGG - Intergenic
962901504 3:139765842-139765864 CTTTGGGGAGCTAGAAAAGTGGG + Intergenic
968830426 4:2930796-2930818 CTGTGGGCACCAGGCAGAGTGGG - Exonic
974184986 4:58433713-58433735 TTGTGTGCATCAATAAAATTAGG - Intergenic
974644244 4:64671788-64671810 CTTTGGTCATCAAGTATAGTAGG - Intergenic
974871023 4:67642209-67642231 CAGTAGGAATCAAGAAAACTTGG - Intronic
975953157 4:79800077-79800099 TAGTTGGCATCAAGAAGAGTGGG - Intergenic
977239366 4:94548098-94548120 CAGTTGGCATCAAGAAAATCAGG - Intronic
978556744 4:109989117-109989139 CTGTGTGTATAAAGAAAAGGAGG + Intronic
980725922 4:136760664-136760686 CTGTGGTCAGCAAGAGGAGTTGG - Intergenic
985839275 5:2293866-2293888 CTGGGGGCATCCACAGAAGTGGG + Intergenic
985978144 5:3438510-3438532 ATGTAGGTATCAAGAAAAGCAGG - Intergenic
987269013 5:16285764-16285786 TTGTGGGTATCATGAAAACTTGG + Intergenic
988117961 5:26920652-26920674 CTGTTTGCTTGAAGAAAAGTGGG + Intronic
988867955 5:35355877-35355899 CTTTGATCATCAAGAAAAGAAGG - Intergenic
991024076 5:62011132-62011154 CTTTGGTCATCCAGAAATGTCGG - Intergenic
995881326 5:116847642-116847664 TTGTGGGCATCTAGAAAAAAGGG + Intergenic
996744809 5:126838221-126838243 ATTTGGGCATTAAGAAAAATTGG + Intergenic
998125203 5:139614674-139614696 CTGTTGATAACAAGAAAAGTGGG - Intronic
999199402 5:149805192-149805214 CTGTGAGAATCCAGCAAAGTGGG - Intronic
1001629579 5:173164715-173164737 ATCTGGACATCAAGAAAAGAGGG - Intergenic
1001720271 5:173851453-173851475 CTGTGGCCATTAAGAAAAAAAGG + Intergenic
1007054951 6:38873879-38873901 CTGTTGCAATCAAGAAAACTTGG + Intronic
1007595005 6:43045873-43045895 CTGTGGGGCTCAAGACAGGTGGG + Intronic
1008690953 6:53977902-53977924 CTGTGTCCATGAAGAAAACTGGG - Intronic
1011450900 6:87490676-87490698 CTGTGGTCTCCAAGAAAACTAGG + Intronic
1012482527 6:99683228-99683250 CTGGGGGGTTCAAGAAAAGCAGG - Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1012976634 6:105787101-105787123 CTGTTGGCTGCAAGAAAAGGTGG - Intergenic
1013167471 6:107606736-107606758 CTGTAGGCAGAAAGCAAAGTAGG - Intronic
1013784191 6:113761198-113761220 CAGTGGGCATCAAAAATACTAGG + Intergenic
1017165877 6:151408062-151408084 CAGTGGACATGAAGAAAAGGTGG + Intronic
1017517286 6:155168250-155168272 CTGTGCACATTAAAAAAAGTAGG + Intronic
1017528260 6:155262094-155262116 CTGTGGTCATCAGGGAAAGAGGG + Intronic
1018408820 6:163519403-163519425 CTGTGGGCCTTAAAAAGAGTGGG + Intronic
1020405037 7:7823517-7823539 CTTTGGGCTTCAAAAAAATTGGG - Intronic
1022015668 7:26346497-26346519 CTGTGTGAATCAAAATAAGTGGG - Intronic
1025986401 7:66456581-66456603 CTGTGGGCAACGACACAAGTAGG - Intergenic
1026778158 7:73244821-73244843 CCGTGTGTTTCAAGAAAAGTGGG - Intergenic
1027019012 7:74798215-74798237 CCGTGTGTTTCAAGAAAAGTGGG - Exonic
1027069018 7:75147722-75147744 CCGTGTGTTTCAAGAAAAGTGGG + Exonic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028094500 7:86743712-86743734 CTGTTGGTATAAAGAAGAGTAGG + Intronic
1028739078 7:94251266-94251288 CTCTGGGAACCAAGAAAATTTGG + Intergenic
1028925805 7:96355825-96355847 CTATGGGCAGCAAAAAGAGTAGG - Intergenic
1030568173 7:111187195-111187217 CTGTGGGCAGCAAGAAAATTAGG + Intronic
1030704123 7:112673715-112673737 TTGTGGGATTAAAGAAAAGTGGG - Intergenic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1031311323 7:120201094-120201116 CAGAGGCCATCAAGAAAAGTGGG + Intergenic
1032336020 7:131025543-131025565 CTGTGGGCATCATGAACATTTGG - Intergenic
1032481827 7:132253544-132253566 TTGTGGGTATAAAGAAAAGTTGG - Intronic
1032703646 7:134403824-134403846 CTGTGGGGATGAAGAAATGTGGG + Intergenic
1034453700 7:151152337-151152359 CTGAGGGCATTCTGAAAAGTGGG - Intronic
1035874080 8:3168357-3168379 CTGTGCGCATCTAGAAAAAGAGG - Intronic
1036095511 8:5720750-5720772 ATATAGGCATCAAGAAAAGGAGG + Intergenic
1037110111 8:15155755-15155777 CTTTAGGCATAAAGAAGAGTGGG + Intronic
1038231157 8:25701754-25701776 CTGTCGGCATCAAGACTAGGTGG - Intergenic
1041764921 8:61408850-61408872 CTCAGTGCATTAAGAAAAGTTGG + Intronic
1045351331 8:101343018-101343040 TTATTGGCATCACGAAAAGTTGG - Intergenic
1045910992 8:107409840-107409862 CAGTGGGCCTCATGAAAAGTAGG + Intronic
1046342292 8:112875322-112875344 GTGTAGGCAGCAAGAAAGGTTGG - Intronic
1047738689 8:127789506-127789528 CCGTGAGCATGAAGAAAGGTGGG + Intergenic
1048252435 8:132877804-132877826 TTGTGGGCATACAGAAAATTAGG + Intronic
1048907766 8:139104842-139104864 CTGTGGGCACCCAGAAGAGATGG - Intergenic
1050445247 9:5715243-5715265 CTGTAGGTACCAAGAAAAGGTGG + Intronic
1050871401 9:10575163-10575185 CTGTAGACATCAACAAAAATAGG + Intronic
1050947900 9:11549594-11549616 CTTTGGGCATCAACAAGAATGGG + Intergenic
1052225791 9:26084329-26084351 CTGTAGGCATCAATAAATGTTGG - Intergenic
1057041865 9:91853808-91853830 CTGTGGGCAGCAAGGACTGTGGG + Intronic
1057830611 9:98403357-98403379 CTGTGACCCTCAAGAAAAGCTGG + Intronic
1057915403 9:99051650-99051672 CAGGGGCCATCAAGAAAAGATGG - Intronic
1057964559 9:99490301-99490323 CTGTGGCCATCAGGAAAGTTGGG - Intergenic
1059768748 9:117408278-117408300 GTGTGGGCTTCAAGACAATTGGG + Intronic
1061110197 9:128563945-128563967 CAGAGGTCATCAAGAAATGTTGG - Intronic
1203434265 Un_GL000195v1:122882-122904 CTGTGTGTAGCAAGAAAAGATGG + Intergenic
1186123218 X:6384925-6384947 CTGTGTTCATAAAGAGAAGTGGG + Intergenic
1186729231 X:12390807-12390829 CTGTGAGCAGAAAGAAAATTAGG - Intronic
1189303497 X:39969718-39969740 TTGTGGGCATCCAGATATGTTGG + Intergenic
1192888076 X:75358307-75358329 CTGTAGTCCTCAAGAAAAGGGGG - Intergenic
1193806389 X:86000857-86000879 CAGAGGGCATGAAGTAAAGTTGG + Intronic
1194897428 X:99461577-99461599 CAGAGGGCATCAAGAGAAGTAGG + Intergenic
1196050581 X:111299566-111299588 GTGTGGGCATAAAGAATGGTGGG - Exonic
1197353510 X:125405261-125405283 CTGTGGGCATTAAATTAAGTGGG + Intergenic
1200105739 X:153711049-153711071 CTGGGGGCAGCAAGGAAAGGAGG - Intronic