ID: 903999572

View in Genome Browser
Species Human (GRCh38)
Location 1:27331183-27331205
Sequence GGGTGTGGCCATGGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 521}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903999572 Original CRISPR GGGTGTGGCCATGGAGAAGA GGG Intronic
900243022 1:1625807-1625829 GGGTGGGGTCAAGGAGAAGAGGG + Intronic
900750016 1:4389792-4389814 GGGCAGGGCCGTGGAGAAGATGG + Intergenic
901079362 1:6575098-6575120 GGGCGTGGCCATCCAGAAGAGGG + Exonic
901101863 1:6725355-6725377 TGGTCTGTCCCTGGAGAAGAGGG + Intergenic
901122196 1:6905110-6905132 GGCAGTGGAGATGGAGAAGATGG - Intronic
901175996 1:7299623-7299645 GAATGTGGCCAGGGAGGAGATGG - Intronic
901254721 1:7812753-7812775 GGATGTGACTTTGGAGAAGAAGG + Intronic
901843355 1:11966910-11966932 GTGTGTGGCCCTGAAGAGGAAGG + Intronic
902280016 1:15367536-15367558 GAGTGTGCTCAAGGAGAAGATGG + Exonic
902415662 1:16237215-16237237 GGTTGTTGCCATGGAGACGCCGG + Intergenic
902733468 1:18384675-18384697 GGGAGAGGCCAGGGAGCAGAGGG + Intergenic
902896694 1:19484878-19484900 GGCTGAGGCCACGGAGAAGAGGG + Intronic
903071608 1:20729590-20729612 CGGTGTGGCCAAGGACAAGGAGG - Intronic
903215152 1:21839606-21839628 GAGGGTGGCCATGGTGAGGAAGG + Intronic
903281819 1:22254596-22254618 GGGAGCAGCCATGGAGAAGCAGG + Intergenic
903974135 1:27138188-27138210 TGGTGTGAGAATGGAGAAGAGGG - Intronic
903999572 1:27331183-27331205 GGGTGTGGCCATGGAGAAGAGGG + Intronic
904293068 1:29500066-29500088 TGAGGTGGCCATGGAGAACAGGG + Intergenic
904400457 1:30253481-30253503 GAGTGTGGTCAAGGAGAAGAAGG + Intergenic
904888577 1:33760881-33760903 GGGTGTGGTAAGGGAGAAGTGGG - Intronic
905635428 1:39548146-39548168 GGGTGTGACTATGTTGAAGATGG + Intergenic
906104686 1:43284797-43284819 GGGCGTGGCCAGGGAGCAGGAGG - Intronic
906186879 1:43869047-43869069 GGGTAAGTCCAAGGAGAAGATGG + Intronic
906488031 1:46246943-46246965 CGGTTTGGCCTTGGAGAGGAAGG + Intergenic
906696959 1:47829534-47829556 GGGAGTGGTGATGGAGAGGATGG - Intronic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907351828 1:53838250-53838272 GGCCGTGGCCATGGAGATGGCGG + Exonic
908666726 1:66500518-66500540 GGATGTGGGCAAGGAGAAAAGGG + Intergenic
908980861 1:69956320-69956342 GAGTGTGGGTGTGGAGAAGAGGG - Intronic
909056317 1:70825395-70825417 AGGTGTAGGAATGGAGAAGACGG + Intergenic
909380865 1:74996937-74996959 TGTTGTGGCTATGGAAAAGAGGG - Intergenic
911545089 1:99206826-99206848 TGGTGAGGCTATGGAGAAAAGGG - Intergenic
911548079 1:99244970-99244992 AGGTGTGTCCATGGATTAGAAGG + Intergenic
911548544 1:99251600-99251622 TGGTGAGGCTATGGAGAAAAGGG + Intergenic
911593081 1:99770178-99770200 GGCAGTGGAGATGGAGAAGAGGG - Intergenic
913130505 1:115834348-115834370 GGCTGTGGGCAAAGAGAAGAAGG + Intergenic
913273011 1:117112420-117112442 GGCTGTGGCCATGGACACAAAGG - Exonic
915042602 1:152981554-152981576 GGGTGGGGACTTGGTGAAGAAGG + Intergenic
915336839 1:155148637-155148659 GGCTCTGGCTTTGGAGAAGAAGG - Intergenic
915483678 1:156204996-156205018 GTTTGTGGCCAGGGAGAAGTAGG - Intronic
915720103 1:157978647-157978669 GAGTGTGGCCCTGGGGAAAATGG - Intergenic
916145469 1:161735263-161735285 GGATGTGTCCAGGGAGAATACGG + Intergenic
917035084 1:170740093-170740115 AAGTGAGGGCATGGAGAAGAAGG + Intergenic
917597463 1:176543637-176543659 AGGTGTGGCATTGGAGATGAAGG - Intronic
917969958 1:180199977-180199999 GGGTGTGGGGGTGGAGGAGAGGG + Exonic
918005831 1:180541446-180541468 GGGTGTGGCACGGGTGAAGAGGG - Intergenic
918314763 1:183313958-183313980 GTGTGTGGCCACTGAGAACAGGG + Intronic
918659949 1:187075210-187075232 AGGTGTGGTCATGGAGTAGAAGG - Intergenic
919091661 1:192984854-192984876 GGGTGTGGGGAGGGAGTAGAGGG - Intergenic
919334493 1:196214595-196214617 AGGTGTGGTAAAGGAGAAGAGGG + Intergenic
920171088 1:204073031-204073053 GGGTGGGGACTTGCAGAAGAAGG - Intergenic
920312534 1:205057061-205057083 GGGTGGGGACTTGGAGGAGAAGG - Intronic
920449762 1:206051103-206051125 GTGGGTGGCCAAGGGGAAGAAGG - Intronic
920649022 1:207823168-207823190 GGGTGTGGGCTGGGAGAAGTGGG - Intergenic
921095347 1:211882558-211882580 TGGTGAGGCCGTGGAGAATAGGG - Intergenic
921260900 1:213384388-213384410 GGATGTGGCCAGGAGGAAGAGGG + Intergenic
921730829 1:218576239-218576261 TGGTGAGGGCATGGGGAAGAGGG + Intergenic
922433446 1:225580071-225580093 GGGTGTGGGGAAGAAGAAGAAGG - Intronic
922565184 1:226597017-226597039 GGGAGTGGCCAGGGACAGGAAGG + Intronic
923276732 1:232403224-232403246 GGGTGTGCCCATGGAGCAGAGGG + Intronic
923385848 1:233464650-233464672 GGAAGTGGGGATGGAGAAGAGGG - Intergenic
923496649 1:234531424-234531446 GGGGCTGACCATGGGGAAGAAGG - Intergenic
923963758 1:239112762-239112784 GGTTGTTGGCATGGAGAAGCTGG + Intergenic
924003732 1:239583637-239583659 GGGTGTGGGGAAGGAGAAAAGGG - Intronic
924243343 1:242060146-242060168 GGGTGAGGGCATGGATGAGATGG + Intergenic
924907134 1:248467793-248467815 TGGTGAGGACATGGAGAAAAGGG - Intergenic
924916980 1:248580355-248580377 TGGTGAGGACATGGAGAAAAGGG + Intergenic
1063106568 10:2997525-2997547 GGGTAGAGCCATGGAGAAGCGGG + Intergenic
1063957586 10:11281053-11281075 GAGTGAGGACACGGAGAAGAGGG - Intronic
1064605413 10:17033906-17033928 GGCTGTAGACATGGAGAATATGG + Intronic
1064987291 10:21223681-21223703 TGGTGAGGACATGGAGAAAAGGG - Intergenic
1065033283 10:21610360-21610382 TGGTGTGGCCAAGAAGATGAGGG - Intronic
1065194925 10:23255089-23255111 GGAAGTGGCCAGGGAGAGGAGGG + Intergenic
1065552258 10:26879848-26879870 GGGTGTGCCCATGGAAACAAAGG + Intergenic
1065809256 10:29426430-29426452 TGGTGTGACCCTGGAGTAGATGG + Intergenic
1067068763 10:43117978-43118000 GGGAGAGGCCCTGGAGAAGGTGG - Intronic
1067319018 10:45199445-45199467 GACTGGGCCCATGGAGAAGAAGG + Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1067917707 10:50418411-50418433 GGGTGTGGCCCGGCAGCAGAGGG + Intronic
1069428552 10:68312317-68312339 TGGTGAGGACGTGGAGAAGAGGG - Intronic
1070683431 10:78465023-78465045 GGGAGTGGACATCAAGAAGAAGG + Intergenic
1072614082 10:97038039-97038061 GGGAGTGTCCATGGACAAGGAGG - Intronic
1072688252 10:97551716-97551738 GGGTGCAGCCATGGAAAAGTGGG - Intronic
1073083927 10:100876574-100876596 GGGTGGGGGCATGGAGAAGGGGG - Intergenic
1073139727 10:101239101-101239123 GGGTGTGGCAGGGGAGAGGAAGG - Intergenic
1073293572 10:102425227-102425249 GGGTGGGGGCAGGCAGAAGAAGG - Intronic
1073469300 10:103712859-103712881 GGGTGTGGACTTGGAGCTGAAGG + Intronic
1073579739 10:104654437-104654459 TGGTGAGGACATGGAGAAAAGGG - Intronic
1073636071 10:105200237-105200259 GGGTGTGGATTTGGAGAAAAGGG + Intronic
1076301101 10:129426955-129426977 GGGTCTGGCAAAGGAGAAGCAGG + Intergenic
1076310801 10:129506282-129506304 GGGTGGGGCCAGGGACAAGCTGG - Intronic
1076623853 10:131809749-131809771 GTGTGTGGCTACGGGGAAGACGG - Intergenic
1076674696 10:132141919-132141941 GGGCATGGCCAAGGAGGAGACGG + Exonic
1076994883 11:292996-293018 GGGTGAGGCCATGGTGGGGAGGG + Exonic
1077146624 11:1049350-1049372 GGGTGAGGCCAAGGAGCAGAGGG - Intergenic
1077174237 11:1181430-1181452 GGGTGTGGAGAAGGAGAAGGTGG - Intronic
1077234291 11:1472477-1472499 GGTTGTGGCCATGGTGTGGAGGG - Intronic
1077368192 11:2169733-2169755 GGCTGTGGCCTTTGAGGAGAAGG - Exonic
1077490890 11:2860473-2860495 GGGTGCGCCCATAGAGGAGATGG - Intergenic
1078665909 11:13325008-13325030 AGCTGTGGGGATGGAGAAGAGGG + Intronic
1078748035 11:14133955-14133977 TGATGTGGCCCTGGAGCAGAGGG + Intronic
1078933135 11:15928575-15928597 GGGTGTGGCGATGCATCAGAGGG + Intergenic
1079019377 11:16896528-16896550 GGCTGTGGGGATGGAGAGGATGG - Intronic
1079236710 11:18696287-18696309 GGCTGTAGCCATGGAGAAGCAGG + Intronic
1079593035 11:22204704-22204726 TGGTGAGGCTGTGGAGAAGAAGG + Intronic
1081637361 11:44729400-44729422 GGGTGGGGGTAGGGAGAAGAGGG - Intronic
1081671569 11:44945532-44945554 GGGAGTTGCCATGGGGAAGATGG - Intronic
1081910594 11:46697457-46697479 GGGGGTGGGCAGGAAGAAGAGGG + Intronic
1082654155 11:55832665-55832687 GGTAATGGCCATAGAGAAGAAGG - Intergenic
1083253138 11:61481294-61481316 GGGCAAGGCCATGGAGATGAGGG + Intronic
1083254424 11:61487417-61487439 GCGTGTGGGAGTGGAGAAGAGGG + Intronic
1083488017 11:62995677-62995699 GGGTGTGGGCAGGGAGAGGGGGG + Intronic
1083553713 11:63609590-63609612 GGGTGAGGACAGGGAGGAGAAGG + Intronic
1083587765 11:63872874-63872896 GGGTGGGGGCAGGGAGAAGTGGG - Intronic
1084196159 11:67524365-67524387 GGGCTGGGCCATGGAGATGAGGG + Intergenic
1085023219 11:73221906-73221928 GGGAGTAGGCATGGAGTAGAAGG + Intronic
1085378311 11:76088448-76088470 GGGGGTGGCATAGGAGAAGATGG - Intronic
1085644273 11:78213114-78213136 GGCTGTGTCCTTGGGGAAGAAGG - Intronic
1087158952 11:94930529-94930551 AGGTGTGGCCATGGAGTAAAGGG + Intergenic
1087456345 11:98391745-98391767 GGATCTGGCTAAGGAGAAGAAGG + Intergenic
1087591083 11:100188596-100188618 TGGTGAGGCTGTGGAGAAGAGGG + Intronic
1088691594 11:112333118-112333140 GGGTGTACCAATGGAGAAGCAGG - Intergenic
1089159794 11:116428678-116428700 GTGAGTGGCCAGGGAGAAGATGG + Intergenic
1089274285 11:117323726-117323748 TGGTGAGGATATGGAGAAGAGGG - Intronic
1090457204 11:126860537-126860559 GGGTGTGGCCAGGCAGCAGGCGG + Intronic
1090655678 11:128842732-128842754 GAGCGTGGCCAAGGAGAGGAAGG - Intronic
1090794674 11:130124490-130124512 AGGAGTAGCCATGGAGAAAAGGG - Intronic
1091303303 11:134521621-134521643 AGGGGTGGCCAGGGAGAGGAGGG - Intergenic
1091969255 12:4772094-4772116 GGGTGAGGACGTGGAGAGGAGGG + Intronic
1092079563 12:5704127-5704149 GGGTGTGGGGGTGGGGAAGAGGG + Intronic
1092751225 12:11721074-11721096 TGGTGAGGCTATGGAGAAAAGGG + Intronic
1092893292 12:12989512-12989534 GGGTATGGCCATAGAGCAGAAGG + Intronic
1094182788 12:27609849-27609871 AGGGGTATCCATGGAGAAGAGGG + Intronic
1094734126 12:33214092-33214114 TGGTGAGGACATGGAGAAAAGGG - Intergenic
1095246808 12:39932880-39932902 GGGTGGGATGATGGAGAAGATGG + Intronic
1095279038 12:40327764-40327786 GGTAGTGGAAATGGAGAAGAAGG + Intronic
1095795651 12:46216192-46216214 GGGGGTGGGGATGGAGAAGCAGG - Intronic
1095850076 12:46792887-46792909 GGATGTGGACATGGAAAACAGGG - Intronic
1096778118 12:53975966-53975988 GGGCGGGGCCTTGGCGAAGACGG - Exonic
1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG + Exonic
1097369412 12:58758294-58758316 GGGAGTGGGCATGGAAAAGGAGG + Intronic
1098060848 12:66560674-66560696 TGGTGAGGACATGGAGAAAAGGG + Intronic
1098577382 12:72058494-72058516 GGGTGCAGCCATAGAGTAGAGGG - Intronic
1098845499 12:75530418-75530440 TGGTGAGGCTATGGAGAAAAGGG - Intergenic
1099103346 12:78470644-78470666 GGATGTGGCCCTGCAGCAGATGG + Intergenic
1100247809 12:92781270-92781292 GGGTGTGGTGATGGTGAAGCTGG - Intronic
1100932528 12:99626587-99626609 TGGGGTGGTCATGAAGAAGATGG - Intronic
1101082647 12:101204857-101204879 GGGTTTGGCGGGGGAGAAGAGGG - Intronic
1101440212 12:104698272-104698294 GGGTGAGGAGGTGGAGAAGATGG - Intronic
1101752477 12:107593801-107593823 GGGTGGGGCCATGCAGAGGAAGG - Intronic
1101764336 12:107684222-107684244 GGGTGTGGAAGTGGAGAAGTGGG + Intergenic
1102506326 12:113386861-113386883 GGCTGTGGCCAGGGAGGGGAGGG - Intronic
1102644556 12:114395752-114395774 GGGTGTTCCCAGGGACAAGAGGG + Intronic
1103217286 12:119211829-119211851 GGGTGTGGTCATGGAGGTGGGGG - Intronic
1103254211 12:119526769-119526791 TGGTGAGGTCATGGAGAAAAAGG + Intronic
1103450616 12:121026069-121026091 GGGTTTGGACATGGGGATGATGG + Intronic
1104725095 12:131071006-131071028 GGGTGGGGCCATGTACAAGGAGG + Intronic
1105209288 13:18248206-18248228 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1105278262 13:18948579-18948601 GGGTGGGTCCAGGGAGCAGAGGG - Intergenic
1105379620 13:19874924-19874946 GGGTGAGGCTATGGAAAAAAGGG + Intergenic
1106043685 13:26117755-26117777 GGGTGTGTCCAGGGAGCAGGTGG - Intergenic
1106217020 13:27711711-27711733 GGGGCTGGCCAAGGAGAAGATGG - Intergenic
1106236043 13:27861327-27861349 AGGTGTGGCCATGAAGAGGATGG - Intergenic
1106867273 13:33979225-33979247 GGGTCTGGAAATGGAGAAGCAGG - Intergenic
1107885662 13:44872479-44872501 GGGTGTGGGGAGGGAGATGAGGG - Intergenic
1108937485 13:55901718-55901740 GGCTGTGGACATGGTGAAAAGGG + Intergenic
1109796295 13:67317565-67317587 TGGTGAGGCCGTGGAGAAAAAGG - Intergenic
1110884536 13:80616869-80616891 GGGTATGGCCGAGGAGAAGGAGG + Intergenic
1111000750 13:82177196-82177218 GGGTGTGGGAATGGGGATGAGGG + Intergenic
1111304084 13:86383155-86383177 GGGTCTGGACATGGAGAACATGG - Intergenic
1111542070 13:89682121-89682143 TGGTGAGGCTATGGAGAAGTAGG + Intergenic
1111771638 13:92603816-92603838 AGTTTTGGCTATGGAGAAGATGG - Intronic
1112138084 13:96606081-96606103 TGGTGAGGCCATGAAGAAAAGGG + Intronic
1112254235 13:97814822-97814844 TGGTGAGGCTATGGAGAAAAGGG + Intergenic
1112409843 13:99153553-99153575 GGGTAAGGCCATGGAGGAGAAGG + Intergenic
1112928063 13:104701717-104701739 GGGTCTGTCCAGGAAGAAGATGG - Intergenic
1113240880 13:108335709-108335731 GGGTTTGAAGATGGAGAAGAGGG + Intergenic
1113847896 13:113402941-113402963 GGGTGTGGGCAGGGAGCAGTGGG + Intergenic
1114134063 14:19827009-19827031 TGGTGTGGACAAGGAGAAAAAGG + Intronic
1114258445 14:21021449-21021471 AGGTGTGGGCATGAAGGAGAGGG + Intronic
1114413073 14:22518599-22518621 AGGAGTGGTGATGGAGAAGAAGG + Intergenic
1114656682 14:24319959-24319981 GAGTGTGGACATGGGGAGGAGGG - Intronic
1114665954 14:24377327-24377349 GGGTGTAGCCAATGGGAAGAAGG - Exonic
1116526546 14:45912864-45912886 GGGTTAGGCCATGGGGAAAATGG - Intergenic
1117547508 14:56805309-56805331 GAGGGTGGGCATGGGGAAGAGGG + Intronic
1117804791 14:59480448-59480470 TGCTGTGGCCTTGGAGAGGATGG - Intronic
1118224219 14:63884022-63884044 TGGTGTGGCCCAGGAGATGAAGG + Intronic
1118442982 14:65828698-65828720 GTGTGTGGCCTTGGAGAAATGGG + Intergenic
1118816130 14:69315466-69315488 TGGTGTTGCCATGGTGAGGAAGG - Intronic
1118816806 14:69319692-69319714 GGGTGTGGCCATGAAGGAACGGG + Intronic
1118901882 14:69993081-69993103 GGGTGCTGGCATGGACAAGAGGG + Intronic
1120414274 14:84199621-84199643 GGCTGTGAACATAGAGAAGAGGG - Intergenic
1120951302 14:90044587-90044609 GGGTGTGGCGATAGAGCAGGAGG + Exonic
1121440415 14:93945335-93945357 GGCAGTGGGCATGGACAAGACGG - Intronic
1121489686 14:94348943-94348965 AGCTGGAGCCATGGAGAAGAGGG - Intergenic
1122835612 14:104429412-104429434 GGTTGTGGCCGTGGGGAGGAAGG + Intergenic
1123577135 15:21682599-21682621 TGGTGTGGACAAGGAGAAAAAGG + Intergenic
1123613756 15:22125072-22125094 TGGTGTGGACAAGGAGAAAAAGG + Intergenic
1125146531 15:36475861-36475883 GAGTGTGGCCGTGGCGAGGAGGG - Intergenic
1125500708 15:40239022-40239044 GGGGGTTGCCATGGGGAGGAAGG - Intronic
1126067826 15:44839427-44839449 GGGTGTGGCACAGAAGAAGATGG + Intergenic
1127627000 15:60789410-60789432 GAGTTTGGCCATGGAATAGAAGG - Intronic
1128081030 15:64857000-64857022 GGGTGTGGGGCTGGAGAAGCAGG - Intronic
1128173155 15:65530622-65530644 CAGTGTGGCCATGGAGAATCAGG + Exonic
1128185149 15:65638317-65638339 GGGTGAGGCAAGGGAGGAGAGGG + Intronic
1130384742 15:83401219-83401241 GGCAGTGGCTATGGAGAAGTTGG - Intergenic
1131456198 15:92584547-92584569 GAGAATGGGCATGGAGAAGATGG + Intergenic
1131818567 15:96247792-96247814 TGGTGAGGCTGTGGAGAAGAGGG - Intergenic
1132063273 15:98710186-98710208 GGGCGTGGCCTTGGGGAAGCAGG - Intronic
1202986003 15_KI270727v1_random:416844-416866 TGGTGTGGACAAGGAGAAAAAGG + Intergenic
1132490382 16:225886-225908 GGGTCTGGCCAAGGAAAACATGG + Intronic
1132689085 16:1174501-1174523 GGGTGTGGCCATGGGGAGGGAGG + Intronic
1133629294 16:7604012-7604034 AGTGGTGGCAATGGAGAAGAAGG + Intronic
1134013785 16:10874429-10874451 GGGTGTGGGGATGGAGAGGGAGG - Intergenic
1134634110 16:15779237-15779259 GGGTGAGGTCATGGGGAAAAGGG - Intronic
1134769621 16:16796024-16796046 GTGTGTTGCTATGGAGAAGAAGG + Intergenic
1135915748 16:26604080-26604102 TGCTGGGGCCATGGAGAAGCAGG + Intergenic
1135939965 16:26814093-26814115 GAGTGTGGACATGGATAGGATGG + Intergenic
1136748886 16:32615538-32615560 GAGTGTAGCCATGAAGAACATGG - Intergenic
1137589630 16:49685709-49685731 AGGTGGGGACATGGAGAGGATGG - Intronic
1138415688 16:56870181-56870203 GGGTGTGGCCATGCACACGGTGG + Exonic
1138582888 16:57953050-57953072 GGGTAGGGCCACGGAGAAGCTGG - Intronic
1139448636 16:67013946-67013968 GGGCGTGGCGAGGGAGAAGCTGG - Intergenic
1140052922 16:71498793-71498815 GGGTGTGCTCGGGGAGAAGAGGG - Intronic
1140700945 16:77581073-77581095 GGATCTGTCCAAGGAGAAGATGG + Intergenic
1140819363 16:78648680-78648702 GGCTGTGGACATGGGGAAGCCGG - Intronic
1141211448 16:81984319-81984341 TGGTGAGGCTATGGAGAAAAGGG + Intergenic
1141623654 16:85250179-85250201 TGGTGTGGGCAAGGGGAAGAGGG - Intergenic
1141635809 16:85313267-85313289 GGGTCTGCCCAAGGAGAAGCAGG - Intergenic
1141998395 16:87649051-87649073 GGGTGTGGCAGTGGAGACGAGGG + Intronic
1142227086 16:88882832-88882854 GGGTGGGGCCTGGGAGCAGAGGG - Intronic
1203051019 16_KI270728v1_random:874752-874774 GAGTGTAGCCATGAAGAACATGG - Intergenic
1143499489 17:7330442-7330464 CAGTGGGGCCATGGAGAAGGTGG + Intergenic
1143774197 17:9186921-9186943 GGTTGTGGGGAGGGAGAAGAGGG + Intronic
1144011227 17:11150210-11150232 GGATGTGGCATTTGAGAAGATGG - Intergenic
1144096144 17:11902428-11902450 AGGTGTGTACATGGAAAAGAGGG - Intronic
1145924372 17:28634715-28634737 GTGTGTTGCCATAGAGACGACGG + Exonic
1146276573 17:31519796-31519818 GGGTCTGTGGATGGAGAAGAGGG + Intronic
1146693016 17:34889653-34889675 GGTTGTGGCTCTGGAGATGAGGG - Intergenic
1147032872 17:37655108-37655130 GGGTGTGGGGAGTGAGAAGAGGG + Intergenic
1147169878 17:38611741-38611763 GGGTGTGGCCCTGCAGGAGTTGG - Intergenic
1147476260 17:40714524-40714546 TGGGGTGGCTAGGGAGAAGATGG + Intergenic
1147637288 17:41971902-41971924 GGATGAGCCCAGGGAGAAGATGG + Exonic
1147953655 17:44120813-44120835 GGCTGTGGCCATGGTCAGGAGGG - Intronic
1148239120 17:45988406-45988428 GGGCATGGCCCTGGAGGAGAAGG - Intronic
1148718598 17:49733811-49733833 GAATGTGGCCATGGAAAACAGGG - Intronic
1148735798 17:49864267-49864289 GAGTGGGGTCAGGGAGAAGAAGG + Intergenic
1149461726 17:56834343-56834365 GGGTGGGGCCCGGGAGGAGACGG + Intronic
1149557481 17:57584441-57584463 GGGTGGGGTCATGGAGATGCTGG + Intronic
1150001843 17:61445189-61445211 GGGTGTGGGGTAGGAGAAGAGGG + Intergenic
1150118556 17:62578222-62578244 AGGAGTGGGCATGGAGAGGAGGG + Intronic
1150727644 17:67664440-67664462 TGGTGAGGCCGTGGAGAAAACGG - Intronic
1150917725 17:69453462-69453484 AGGTGTGGACATGGAGATGTAGG + Intronic
1151567027 17:74904434-74904456 GGGTGTTCTCATGGAGGAGAGGG - Intergenic
1151597345 17:75086652-75086674 TGGTGTGGGGATGGAGATGAGGG + Intergenic
1151875634 17:76866835-76866857 GTGTGTGGCCCAGGGGAAGAGGG + Intergenic
1152043928 17:77923686-77923708 GGGTGTGTCCCTGGGGATGAGGG - Intergenic
1152248701 17:79200299-79200321 GGGAGTGGCTGTGGTGAAGAGGG - Intronic
1152269727 17:79317116-79317138 GGGGGTGGCCGTGGGGGAGATGG - Intronic
1152372152 17:79895557-79895579 TGGTGAGGACATGGAGAAGATGG + Intergenic
1152802982 17:82340280-82340302 GGGGGAGGGCATGGGGAAGAGGG - Intergenic
1155294281 18:24371143-24371165 GGGTGTGGTTATGGAGAAACTGG - Intronic
1157442846 18:47723522-47723544 GGGGGGCGCCATGGAGAAGGAGG - Intergenic
1158102436 18:53844230-53844252 GGAGGTGGGCAGGGAGAAGAGGG + Intergenic
1158845541 18:61438612-61438634 TGGTGAGGCTATGGAGAAAAGGG + Intronic
1158852264 18:61506764-61506786 GGGTCTGTCCATGGAGAGGCAGG + Intronic
1158880115 18:61769927-61769949 GGTTATGGCCAGGGAGATGAAGG - Intergenic
1159106003 18:64002677-64002699 GGGTGAGGCCTTGGAGAAGCCGG + Intronic
1159552775 18:69913165-69913187 GGGTGTGGAGACGGGGAAGATGG - Intronic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1160417082 18:78718985-78719007 GGCTGTGTCCATGGAGATCAAGG + Intergenic
1160427480 18:78788103-78788125 TGGGGTGGCCATGGAGGAAAGGG - Intergenic
1160868511 19:1266638-1266660 GGGCGTCGCCATGGAGACGAGGG - Intronic
1160942550 19:1627183-1627205 GGGTGTGGACCGGGAGCAGAGGG - Intronic
1160980006 19:1812378-1812400 GGGTGGGGCCAAGGCGAAGAAGG + Intergenic
1161766979 19:6213559-6213581 CGGTGTGGCCTTGGAGCTGAGGG - Intronic
1161805432 19:6440672-6440694 GGGGGTGGCCATGCAGAGGTGGG + Exonic
1161983920 19:7643903-7643925 GGGTGGGGCCTTGGAGAGGTAGG + Intronic
1162386127 19:10361648-10361670 GGGTGTGTCCGTGGAGGAGGTGG - Intronic
1162402079 19:10452778-10452800 GGGTGTGTCCATGGAGGGGATGG + Intronic
1162966532 19:14158848-14158870 GGATGGGGCCATTGAGATGAAGG - Intronic
1163233930 19:16020386-16020408 GGCTGGGGCCTGGGAGAAGAGGG - Intergenic
1163312502 19:16522638-16522660 GGGGGTGGCCCTGGAGAAGCCGG - Intronic
1164528940 19:29032725-29032747 GGGTGTGGAGGTGGAGAAAAGGG + Intergenic
1164741153 19:30576403-30576425 GGGTGGGGCTCTGGAGAAGGAGG - Intronic
1166929378 19:46292635-46292657 GGAAGGGGCCATGGAGATGAAGG - Intergenic
1168322746 19:55519723-55519745 GGGAGTGGTCATGGTGATGAGGG + Intergenic
1168493380 19:56829889-56829911 GGCTGTTGCCATGGAGAAGCTGG - Intronic
925640068 2:5978805-5978827 GGGTGTGGCCAGGGCAAAGCTGG + Intergenic
926216621 2:10909537-10909559 AGGTGTGGCCAGGCAGAAGCAGG - Intergenic
926878906 2:17518606-17518628 GGGTGGGGGCAGGGAGAGGAGGG - Intergenic
926909927 2:17843041-17843063 GGGTGTGGACATTGGGAAGGAGG + Intergenic
927503233 2:23596085-23596107 TGGGGTTGCCATGGAGAAGCTGG + Intronic
928013091 2:27629040-27629062 GGGTGGGGCCAGGAGGAAGATGG + Exonic
928269461 2:29843139-29843161 GGTTGTGTTCATGGAGAGGAGGG + Intronic
929234708 2:39593674-39593696 GGTTGGGGCCATGGGGAAGGAGG + Intergenic
929987190 2:46746191-46746213 GGCAGTGGAGATGGAGAAGAGGG + Intronic
931896931 2:66742891-66742913 GTGTGTAGCCATTGAGGAGATGG + Intergenic
932452069 2:71817356-71817378 GTGTGTTGCCCTAGAGAAGAGGG + Intergenic
932663830 2:73680317-73680339 GGGAGTGGGCATGGGGAAAAGGG + Intergenic
932769282 2:74491591-74491613 GGGTCTGGCCCTCCAGAAGATGG + Exonic
934935315 2:98461030-98461052 GGGCGTGGCTATGGAGAAGATGG - Intronic
935127626 2:100238523-100238545 GGCAGTGGCCAGGGAGAAAAAGG - Intergenic
935348061 2:102127036-102127058 GGGTGTGGCCATCCTGGAGATGG + Intronic
935823879 2:106922267-106922289 TGGTGGGGACGTGGAGAAGATGG - Intergenic
936733146 2:115407636-115407658 GGGTGTGTACATGGAGAGGGAGG + Intronic
936959636 2:118059393-118059415 GGAGGTGGCAATGAAGAAGATGG - Intergenic
937315299 2:120928225-120928247 GGGTGTGGGCATGAAGATGCTGG - Intronic
938191154 2:129281957-129281979 GGGTGTGGACAAGGAGCACAGGG - Intergenic
938596227 2:132789950-132789972 GGATTTGGTCATGGAGATGAAGG - Intronic
939606414 2:144260345-144260367 GGGTGTGGGTATGCAGAAGAGGG + Intronic
940666422 2:156616056-156616078 GGGTGTGGCAGTGGAGAACAGGG + Intergenic
941517313 2:166494950-166494972 TGGTGTGGCCTTTGGGAAGAAGG - Intergenic
942882496 2:180878411-180878433 TGGTGAGGACATGGAGAAAAGGG + Intergenic
942912507 2:181262719-181262741 GGGTGAGGCTATGGCAAAGAGGG + Intergenic
943640380 2:190351471-190351493 GGTGGTGTCCTTGGAGAAGAAGG - Intronic
944468623 2:200029580-200029602 GGGTGGGGCCCAGGAGAAAAAGG - Intergenic
944580371 2:201126990-201127012 GGGTGTGGGTGTGGAAAAGAAGG + Intronic
945111477 2:206364492-206364514 TTATATGGCCATGGAGAAGATGG - Intergenic
945123051 2:206478577-206478599 GGGAGTGGCCATTTAGGAGAAGG + Intronic
945729699 2:213518594-213518616 TGGTGAGGCTATGGAGAAAAGGG + Intronic
946247654 2:218396669-218396691 GGGTTTGGCACTGGAGAAGATGG + Exonic
946548974 2:220779331-220779353 TGGTGAGGCTATGGAGAAAAAGG + Intergenic
947531061 2:230908884-230908906 GGGTGTGGCCTTGAGAAAGAAGG - Exonic
947536671 2:230944032-230944054 GGCTAGGGCCAGGGAGAAGAGGG - Intronic
947673525 2:231958128-231958150 GGGTGTGGGCGTGGTGATGAGGG + Intergenic
948832860 2:240606763-240606785 GGGAGTGGGCTTGGAGAATATGG + Intronic
1168947164 20:1770730-1770752 GGTGGTGCCCGTGGAGAAGAGGG + Intergenic
1170099146 20:12679296-12679318 GGGTGTGGCTGTGGAGAGAAGGG + Intergenic
1170196724 20:13696490-13696512 GGGAGTGACCTTGGAAAAGAGGG + Intergenic
1170464004 20:16606412-16606434 GTGTCTGGCCCTGGAGAAGAGGG + Intergenic
1171141972 20:22751120-22751142 GGGTGGGGCCAGGGAGTTGAGGG + Intergenic
1171290457 20:23979919-23979941 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1171301089 20:24061094-24061116 GGGTGTGGAGATGGGGACGACGG - Intergenic
1171397383 20:24845060-24845082 TGGTGAGGCTATGGAGAAAAAGG - Intergenic
1172241741 20:33417548-33417570 GAGTGAAGCCATGGAGATGATGG - Intronic
1172433691 20:34913533-34913555 GGGTGGGGCTCTGGAGAAGTAGG + Intronic
1172450121 20:35016028-35016050 GGTTGTGACCATGGAGGACAAGG + Exonic
1172474330 20:35226322-35226344 GGGAGTGGCATTGGAGGAGAGGG - Intergenic
1173069189 20:39745031-39745053 AGCTCTGACCATGGAGAAGAGGG + Intergenic
1173602216 20:44303950-44303972 GGGAGTGGCCATGGAGTAGATGG - Exonic
1173678847 20:44861832-44861854 GGCTTTGGACATGGAGAAAAGGG + Intergenic
1173695612 20:45008667-45008689 TGGTGAGGCTATGGAGAAAAGGG - Intronic
1173783268 20:45774048-45774070 GGGTGTGGCTAGGGAAGAGATGG - Intronic
1174136570 20:48384391-48384413 GGGTGTGGCCAGCGAGGAGGCGG - Intergenic
1174681733 20:52415259-52415281 GGGAGTGGACAGGGAGCAGAAGG - Intergenic
1175224985 20:57439509-57439531 AGGCGGGGCCATGGAGAGGAAGG - Intergenic
1175633065 20:60558260-60558282 GGGTGTTGAAAAGGAGAAGAGGG - Intergenic
1175696969 20:61109837-61109859 GGGAGTGGCCATGGGGAAGCTGG - Intergenic
1175756553 20:61533741-61533763 GGGCGTGGCCATGGGGAGCATGG + Intronic
1175767777 20:61603179-61603201 GGGTGTGGCCAGGGATGACACGG + Intronic
1176021017 20:62962515-62962537 GGCTGAGCCCCTGGAGAAGAGGG - Intronic
1176196823 20:63840753-63840775 GGCCGTGGCCATGGAGATGCGGG + Intergenic
1176247863 20:64105746-64105768 GGGTGTGGGCATGATGATGATGG + Intergenic
1176898101 21:14407057-14407079 TGGTGAGGACATGGAGAAAAGGG - Intergenic
1178642017 21:34352397-34352419 GGGTGTTCCCAGGGAGAAGCTGG + Intergenic
1179168966 21:38957973-38957995 GGCTGTGGGCATGGAGTAAATGG + Intergenic
1179645310 21:42771738-42771760 GGGTGTGGGCATGGGGAGCACGG - Intronic
1180618342 22:17143451-17143473 AGGTGAGGCCGTGGAGACGAAGG + Intronic
1180766971 22:18351091-18351113 GGGTGTGCCCGTGGGGCAGATGG + Intergenic
1180779342 22:18511288-18511310 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1180812059 22:18768608-18768630 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1181198214 22:21202852-21202874 GGGTGTGCCCGTGGGGCAGATGG - Intergenic
1181401530 22:22652952-22652974 GGGTGTGCCCGTGGGGCAGATGG + Intergenic
1181477170 22:23175925-23175947 GGGACTGGCCAGGGAGATGATGG - Intergenic
1181703491 22:24634049-24634071 GGGTGTGCCCGTGGGGCAGATGG + Intergenic
1181886030 22:26023111-26023133 GGCGGTGGTGATGGAGAAGAAGG - Intronic
1182108064 22:27703486-27703508 GGGTGAGGCCCTGGAAAACAGGG - Intergenic
1182288039 22:29259489-29259511 GGATGGGGACATGGAGAGGAAGG + Exonic
1182417268 22:30229382-30229404 GGGTGGGGCCATGGAGGTAAGGG - Intergenic
1183169212 22:36172997-36173019 GGGTGTGGTCATGAAAATGAAGG - Intergenic
1183343537 22:37294836-37294858 GGGATTGGCCAGGGAGAAGGAGG + Intronic
1183426147 22:37740476-37740498 AGCTGTTGCCATGGGGAAGACGG + Intronic
1183538643 22:38417279-38417301 AGGTGGGGCCGTGGAGAGGATGG - Intergenic
1183600138 22:38835335-38835357 GGGTCTGTCCCTGGAGAGGAAGG - Intronic
1184645363 22:45892137-45892159 GGGTGTGGCCAAGGAGATGGAGG - Intergenic
1185395870 22:50587672-50587694 GGGTGAGGCCAAGGAGGAGGTGG + Intronic
1203228593 22_KI270731v1_random:91985-92007 GGGTGTGCCCGTGGGGCAGATGG + Intergenic
949877305 3:8634659-8634681 GTGGGTGTCCATGGAGGAGAAGG + Intronic
950464924 3:13148097-13148119 TGGTGTGGACATGGTGAAAAGGG - Intergenic
950494146 3:13323828-13323850 GGGTGTGGCCAGGTACAGGATGG - Intronic
950533453 3:13566445-13566467 AGGTGGGGGCATGGAGGAGATGG - Intronic
950663185 3:14479620-14479642 GGGTGTTTCCATGGAGAGGTGGG + Intronic
951728407 3:25783824-25783846 GGGTGTGGGCCTGGAGGAGGGGG + Intronic
952479990 3:33751056-33751078 GGGCATTGCCATGGAGAAAAAGG + Intergenic
953066853 3:39481130-39481152 GGGTGTAGACATAGAGGAGATGG - Intronic
953913429 3:46904162-46904184 GGGTGTGGCCAGGGACCCGAGGG - Intergenic
954660427 3:52224133-52224155 GGGTGCTGCCATGGAGAAGTGGG + Exonic
954858000 3:53663413-53663435 TCGTGGGGCCATGGAGAGGATGG + Intronic
954896906 3:53983149-53983171 GGATGTGCCCATGCATAAGAAGG - Intergenic
954967448 3:54624002-54624024 GGGTGTGGAGGAGGAGAAGAGGG + Intronic
956550881 3:70458149-70458171 TGGTGAGGACATGGAGAAAAAGG + Intergenic
956787034 3:72651468-72651490 GGTGGTGGCCATGGTGGAGATGG - Intergenic
956863748 3:73349554-73349576 GGGTATGAGAATGGAGAAGAAGG + Intergenic
958445793 3:94213387-94213409 TAGTGAGGCTATGGAGAAGAGGG + Intergenic
958854666 3:99370250-99370272 GGGTGTTGTCATGGAGAATTGGG + Intergenic
960872701 3:122265832-122265854 GCGTGCAGCCATGGTGAAGATGG + Intronic
960880889 3:122343788-122343810 GGGTGAGGATATGGAGAAAATGG - Intergenic
961020031 3:123497559-123497581 GGGTGAGGACCTGGAGAAGCTGG - Intronic
961835558 3:129655591-129655613 GTGTTTGGCCATGGGGATGATGG - Intronic
963121517 3:141780766-141780788 GGGGCTGGCCGTGGAGATGAAGG + Exonic
963496950 3:146076566-146076588 GGGTGAGGCTACGGAGAAAAGGG - Intronic
963905526 3:150770749-150770771 GGATGTGGGGATGGAGAATAAGG - Intergenic
964565324 3:158044492-158044514 TGGTGTGGACATGGTGAAAAGGG + Intergenic
965854483 3:173071923-173071945 TGGTGAGGCCATGTAGAAAAGGG + Intronic
966245209 3:177800791-177800813 TGGTGAGGCCATGGAGAAAAGGG + Intergenic
966436983 3:179898198-179898220 GGCTGTTGCCATGGTGATGAAGG - Exonic
966815935 3:183889876-183889898 GGGTGTGGCCATAGGGCTGATGG + Intergenic
967709362 3:192687591-192687613 GGGTGTGGACATGGTGGTGATGG - Intronic
968093189 3:195910320-195910342 GGGTGGGGGCAGGGAGGAGACGG - Intronic
968460674 4:723355-723377 GGGTGTGATCATTGAGAGGAGGG + Intronic
968924615 4:3540574-3540596 GGGTGTGGCCATGGGAGAGGAGG - Intergenic
969505252 4:7582729-7582751 TGGTGTGGCCATAGAGAAAGAGG - Intronic
969842194 4:9890838-9890860 GGCTGTGGCCATAAAGAAGGTGG - Intronic
970109913 4:12626273-12626295 TGGTGAGGCTATGGAGAACAGGG - Intergenic
971400859 4:26274175-26274197 GGGTGTGAGCATGGGGCAGATGG - Intronic
971584032 4:28381771-28381793 GGGTATTCCCATGCAGAAGATGG + Intronic
973864194 4:55095344-55095366 GAGTGTGGACATGGGGGAGAAGG - Intronic
974119987 4:57626695-57626717 TGGTGAGGCTGTGGAGAAGAGGG + Intergenic
975282132 4:72573096-72573118 GGGTGTGGGAATGGAAAAAAGGG - Intergenic
975443763 4:74439771-74439793 GGGTTTGGCCATGTTGTAGATGG - Intergenic
976514330 4:85946964-85946986 TGGTGAGGCCAAGGAGAAAAGGG - Intronic
977877813 4:102169557-102169579 GGGTGTTGCCATGGAGACCTGGG - Intergenic
978104122 4:104881198-104881220 GGCTGTGTCCATGAAGCAGATGG + Intergenic
978735399 4:112078274-112078296 GGGTGAGGACATGGATGAGATGG + Intergenic
978789343 4:112644295-112644317 GGGTGTTGCGATGGAGAGGAGGG + Intronic
978964521 4:114725296-114725318 GGGTGAGGCCCTGGAGAGGGTGG + Intergenic
983381769 4:167004654-167004676 GGGTGTGAAGATGGAGAAGAGGG + Intronic
984081361 4:175253236-175253258 GCCTGTGGCCATCGAGATGAAGG - Intergenic
985966561 5:3342652-3342674 TGGTGTGGCCCAGGACAAGAGGG - Intergenic
986044226 5:4022327-4022349 GGGTGTGGCCATCCAGCAGGTGG + Intergenic
986177670 5:5365590-5365612 GGGAGAGGCCTTGGAGAAGTAGG + Intergenic
986929036 5:12795231-12795253 GGCTGGGACCCTGGAGAAGATGG - Intergenic
987037542 5:14033194-14033216 GGGTGTGGCTGGGGAGGAGAGGG - Intergenic
990147088 5:52774375-52774397 GGGTGGGGGCATGGAGACGAAGG - Intergenic
990250326 5:53907412-53907434 GGGAATGGGCATGGAGAAGAAGG + Intronic
991466108 5:66914314-66914336 GGGTGTGCTGATAGAGAAGAAGG + Intronic
991489125 5:67165966-67165988 GGGATTGGCCAGGGAGAAGGTGG + Exonic
992264463 5:75004614-75004636 GGCTGTGATCATGGAGAAAAGGG - Intergenic
993322306 5:86487236-86487258 TGGTGAGGCCGTGGAGAAAAAGG + Intergenic
995047608 5:107669829-107669851 GGGTGGAGGGATGGAGAAGATGG + Intronic
995895189 5:117003265-117003287 TGGTGTGGTCGTGGAGAAAAAGG - Intergenic
996221131 5:120934535-120934557 GGGTGTAGCCATGGCGGAGGTGG + Intergenic
996329166 5:122311391-122311413 GGACGTGGCCAAGGAGAGGAGGG - Intronic
996354349 5:122579784-122579806 GGGTGGGGGTAAGGAGAAGAGGG - Intergenic
997174400 5:131759604-131759626 TGGTGAGGCCGTGGAGAAAAAGG + Intronic
997262391 5:132475069-132475091 GGGTGTGGAGATGGAGGAGGGGG + Intronic
997753206 5:136369948-136369970 GGGTGTGGCCCTGGGAAAGGTGG - Intronic
998584548 5:143413239-143413261 GGGTGTGGATATGGAGATGGTGG + Intronic
999390135 5:151183565-151183587 GCGTGAGGCCCTGGAGAAGGAGG - Exonic
1000138880 5:158381990-158382012 GGGTGTGCCTGTGGAGGAGAGGG - Intergenic
1000430590 5:161147678-161147700 GCTTCTGGCAATGGAGAAGAAGG - Intergenic
1003972463 6:11312322-11312344 GGATGAGGCCATGGGGAAGATGG - Intronic
1005254066 6:23981222-23981244 GGGAGAGGCCATGGAGAAACTGG + Intergenic
1005510808 6:26510096-26510118 GGGTTTGGGCATTGAGATGAGGG - Exonic
1006295324 6:33167577-33167599 GGGTGTGGGCAGGGGGCAGAGGG + Intronic
1006385690 6:33729554-33729576 GGGTATGAACATGGTGAAGAGGG - Intronic
1006474476 6:34245552-34245574 GGCTGTGGCCACAGTGAAGAGGG - Exonic
1007321397 6:41031031-41031053 GGGTGGGGCCGTGGAGCAGTGGG + Intronic
1007655063 6:43446757-43446779 GGGGGTGGGCCTGGAGAAGCTGG - Intronic
1007679454 6:43624412-43624434 TGGTCTGGCCCTGGAGAAGTAGG + Intronic
1007690725 6:43699546-43699568 GGGTATGCCCAAGGAGCAGATGG + Intergenic
1009773329 6:68173698-68173720 TGGTGAGGCTGTGGAGAAGAGGG + Intergenic
1010473134 6:76253743-76253765 TGGTGAGGACATGGAGAAAAGGG - Intergenic
1011203797 6:84869182-84869204 AGGTGTGACAAAGGAGAAGAAGG - Intergenic
1013367284 6:109445839-109445861 TCTTGTGGCCATGGAGAAGGAGG - Exonic
1013808294 6:114017206-114017228 GGGTAGAGACATGGAGAAGAGGG + Intergenic
1014820980 6:125988055-125988077 GGAGGAGGCCATGAAGAAGATGG + Intronic
1015216649 6:130758003-130758025 GTTTATGGCCATGAAGAAGATGG + Intergenic
1015507677 6:134006331-134006353 GGGTGAGGAGATGGAGGAGATGG + Intronic
1016356946 6:143228349-143228371 AGTTGTGGCCAAGGCGAAGATGG + Intronic
1016678258 6:146797205-146797227 GGGTGTGGGCATGATGAAAAGGG + Intronic
1016685678 6:146879790-146879812 GGGTGTGGACAGGGAGATAAAGG + Intergenic
1017400133 6:154051685-154051707 TGGTGAGGCCATGGAGAAAGAGG + Intronic
1019594310 7:1851311-1851333 GGCTGAGCCCATGGAGAAGGTGG + Intronic
1019737200 7:2656459-2656481 GGCTGTGACGAAGGAGAAGAGGG - Exonic
1020739523 7:11996433-11996455 TGGTGAGGCTATGGAGAAAAGGG - Intergenic
1022781233 7:33586403-33586425 GGGTGAGGCCACAGAGAAAAGGG + Intronic
1022958030 7:35399191-35399213 GGGTGTTCCCTTGGAGAAAAAGG + Intergenic
1023878757 7:44307002-44307024 GGGTGTGAGCAGGAAGAAGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1024049194 7:45608081-45608103 TGGTGAGGCCGTGGAGAAAAGGG - Intronic
1024513688 7:50224328-50224350 GGGTGAGGATATGGAGAAAATGG + Intergenic
1024575087 7:50756674-50756696 GGTTCTAGGCATGGAGAAGAGGG + Intronic
1024708648 7:51989863-51989885 TGGTGTGGCTGTGGAGAAAAGGG - Intergenic
1025707389 7:63880116-63880138 GAGTGTGGTAAAGGAGAAGATGG + Intergenic
1026147620 7:67761025-67761047 GAGGCTGGCCATGCAGAAGATGG + Intergenic
1026455473 7:70568715-70568737 GGATGTGGACATGGAGATGGTGG - Intronic
1027939459 7:84655809-84655831 GAGTGTGGCAATTCAGAAGATGG + Intergenic
1028493308 7:91438232-91438254 GGTTATGGCCATGGATGAGATGG + Intergenic
1028699942 7:93765779-93765801 TGGTGAGGCTGTGGAGAAGAGGG + Intronic
1029405115 7:100370215-100370237 AGGTATGGCCATGGAAATGAGGG + Intronic
1029805003 7:102986699-102986721 GGGTGGGGACATGCAGCAGATGG + Intronic
1031344315 7:120646278-120646300 GAGGCAGGCCATGGAGAAGAAGG - Intronic
1032092351 7:128917302-128917324 GGCTGTGGACATGCAGGAGATGG - Intergenic
1032912622 7:136450974-136450996 TGGTGAGGCCGTGGAGAAAAGGG - Intergenic
1033093669 7:138410719-138410741 TGGTGAGGACATGGAGAAAAGGG - Intergenic
1033258574 7:139822696-139822718 GAGTGTGGGGATGAAGAAGAGGG - Intronic
1033488497 7:141816070-141816092 GGTTGTTGGCATGGAGAAGCTGG - Intergenic
1035050897 7:155998591-155998613 GTCTGTGCCGATGGAGAAGATGG - Intergenic
1036234028 8:7022691-7022713 GGGTGTGGCCATGCGGTGGAGGG + Intergenic
1036556144 8:9862154-9862176 GGGTGTGGCCTTGGGCAAGGTGG - Intergenic
1038867091 8:31450988-31451010 TAGTGAGGCCATGGAGAATAGGG + Intergenic
1039341708 8:36657846-36657868 GGGTGTGGGGATGGGGCAGAGGG - Intergenic
1039473808 8:37829017-37829039 GGGGGTGGGCATGGAGCAGGAGG - Intronic
1039908818 8:41808065-41808087 GGGTCTGGCCTTAGAGCAGAGGG - Intronic
1040361203 8:46665997-46666019 TGGTGAAGGCATGGAGAAGATGG + Intergenic
1042416657 8:68527907-68527929 GGCTGTGGGGCTGGAGAAGAGGG + Intronic
1044025696 8:87169063-87169085 TGGTGAGGACATGGAGAAAAGGG - Intronic
1046598284 8:116287060-116287082 TGGTGAGGCTATGGAGAAAAGGG + Intergenic
1047257634 8:123227617-123227639 GGGCTTGGCCAGGGAGAAGGGGG + Intronic
1048472092 8:134712851-134712873 GGGCGTTGCCATGGAGACGCGGG - Exonic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049126384 8:140792669-140792691 GGGACTGGCTATGGAGAAGAAGG + Intronic
1049316622 8:141972585-141972607 GAGTGTGGCCATTTGGAAGATGG + Intergenic
1049380880 8:142315237-142315259 GGGTGTGCCTGTGGAGACGACGG - Intronic
1049411476 8:142475703-142475725 GGGTGGGGCCCTGGAGAGGAGGG + Intronic
1049412309 8:142478721-142478743 GAGTGTGGCCATGGGGTAGCGGG + Intronic
1049412342 8:142478849-142478871 TGGGGTGGCCATGGAGTAGTGGG + Intronic
1049617753 8:143583180-143583202 GTGTGAAGACATGGAGAAGACGG + Intronic
1049774139 8:144396960-144396982 GGGCAGGGCCATGGAGAACATGG + Intronic
1049871872 8:144985911-144985933 TGGTGAGGCCATGGAGAAATAGG - Intergenic
1050092722 9:2031715-2031737 GGCTGGGGCCAAGGAGAAGCAGG - Intronic
1050480861 9:6085694-6085716 GGGTGTGGCCACGGACTAGTTGG - Intergenic
1052973873 9:34398143-34398165 GGGTGTGGGCAAGGGGCAGATGG - Intergenic
1053104508 9:35398489-35398511 GGGTGTGGCAGGGTAGAAGAGGG + Intronic
1053372962 9:37577752-37577774 TGGTGAGGACATGGAGAAAAGGG + Intronic
1053654153 9:40198040-40198062 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1053799698 9:41756605-41756627 GGGTGTGGCCATGGGAGAGGAGG - Intergenic
1053904542 9:42827216-42827238 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054145522 9:61558393-61558415 GGGTGTGGCCATGGGAGAGGAGG + Intergenic
1054188107 9:61968660-61968682 GGGTGTGGCCATGGGAGAGGAGG - Intergenic
1054366267 9:64344256-64344278 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1054465262 9:65489501-65489523 GGGTGTGGCCATGGGAGAGGAGG + Intergenic
1054530442 9:66178299-66178321 GAGGGTGGCCAGGGAGAAGGGGG - Intergenic
1054650409 9:67619916-67619938 GGGTGTGGCCATGGGAGAGGAGG + Intergenic
1054673898 9:67833986-67834008 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1055391142 9:75822906-75822928 GTGAGGGGCCATGGAGGAGAGGG - Intergenic
1056565471 9:87769052-87769074 TGGGGAGGCCATGGAGAAAAGGG - Intergenic
1056578954 9:87876546-87876568 GGGTGGGGGGATGGAGTAGAAGG - Intergenic
1056836218 9:89957711-89957733 GGCTGCCTCCATGGAGAAGAAGG + Intergenic
1056951233 9:91042399-91042421 TGGTGGGGCCATGGAGGAAAAGG - Intergenic
1057379702 9:94556270-94556292 GAGGGTGGCCAGGGAGAAGGGGG + Intergenic
1058572446 9:106361446-106361468 TGGTGTGGATATGGAGAAAAGGG - Intergenic
1058941286 9:109815092-109815114 GGCTGTGGAGATGGTGAAGAAGG + Intronic
1058944176 9:109841554-109841576 GGGTGGGGGGATGGAGAGGAGGG + Intronic
1061299250 9:129695276-129695298 AGGAGAGGCCATGGAGGAGAAGG + Intronic
1061952905 9:133946143-133946165 GGGTGGGACCATGGTGATGAAGG - Intronic
1062185435 9:135215861-135215883 GGGAGTGGCCAGAGAGGAGAGGG + Intergenic
1062510328 9:136901865-136901887 GGGAGTGGGCGAGGAGAAGAGGG - Intronic
1187526786 X:20061506-20061528 TGCTGTGCCCAGGGAGAAGAGGG + Intronic
1187904633 X:24054565-24054587 GGGTGTGGGAACAGAGAAGAGGG - Intergenic
1187923357 X:24227604-24227626 GGGTGAGGACATGGAGAAAAGGG + Intergenic
1188295373 X:28440946-28440968 GGGTGTTGGCATGGAGAAGCTGG + Intergenic
1189060034 X:37743439-37743461 GGGTGTGGTCAGGAAGAAGTGGG + Intronic
1190287191 X:48969561-48969583 GGCTGTGTCCATGCAGAAAAAGG + Exonic
1191008961 X:55740677-55740699 GGGTGTTGTCATGGAGAATTGGG + Intronic
1191031596 X:55979739-55979761 TGCTGTGGGAATGGAGAAGAAGG + Intergenic
1191706297 X:64097909-64097931 TGGTGTTTCCATGGAGATGAAGG - Intergenic
1191714667 X:64186045-64186067 GGGTCTAGACATGGGGAAGAAGG + Exonic
1193910680 X:87302342-87302364 TGGTGTGGCTATGGAGAAATAGG - Intergenic
1194320782 X:92443048-92443070 TGGTGAGGCTATGGAGAAAAGGG - Intronic
1195291358 X:103434199-103434221 GGGTGGGGACATGGAGAGAAGGG + Intergenic
1195646559 X:107237631-107237653 GGCTGCGGAAATGGAGAAGAGGG - Intronic
1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG + Intergenic
1196686511 X:118514808-118514830 TATGGTGGCCATGGAGAAGATGG - Intronic
1198037279 X:132813720-132813742 GGGCGTGGTAATGGAGAGGAGGG - Intronic
1198892377 X:141412297-141412319 GGCAGTGGCAGTGGAGAAGAAGG + Intergenic
1200628894 Y:5556184-5556206 TGGTGAGGCTATGGAGAAAAGGG - Intronic
1202036921 Y:20645598-20645620 AGTTGTGGCTATGGTGAAGAAGG + Intergenic