ID: 904003452

View in Genome Browser
Species Human (GRCh38)
Location 1:27351114-27351136
Sequence TAGGGGTCCTAGCGCCCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904003452_904003457 -6 Left 904003452 1:27351114-27351136 CCCCGAGGGCGCTAGGACCCCTA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 904003457 1:27351131-27351153 CCCCTAGGTTCTGCCCCTGCAGG 0: 1
1: 0
2: 2
3: 17
4: 213
904003452_904003468 28 Left 904003452 1:27351114-27351136 CCCCGAGGGCGCTAGGACCCCTA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 904003468 1:27351165-27351187 CTTCTAGCCGCACCCCATCCGGG 0: 1
1: 0
2: 1
3: 7
4: 109
904003452_904003467 27 Left 904003452 1:27351114-27351136 CCCCGAGGGCGCTAGGACCCCTA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 904003467 1:27351164-27351186 TCTTCTAGCCGCACCCCATCCGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904003452 Original CRISPR TAGGGGTCCTAGCGCCCTCG GGG (reversed) Intronic
900616616 1:3568392-3568414 TAGTGGTCCTAGGCCCCTCATGG + Intronic
904003452 1:27351114-27351136 TAGGGGTCCTAGCGCCCTCGGGG - Intronic
922729467 1:227942279-227942301 TGGGGGTCCTGGCTCCCTGGAGG - Intronic
923541658 1:234892728-234892750 TAGGGCTCCTTGCGCCCTGTAGG - Intergenic
1069913412 10:71773204-71773226 TAGGGGTCCCAGCAGCCTCTGGG + Intronic
1072607292 10:96995301-96995323 CAGAGGGCCTAGCGCCCTCCTGG + Intergenic
1076402042 10:130190804-130190826 TTGGGGTCCGAGCGGCCTCAGGG + Intergenic
1076649601 10:131978824-131978846 TTGGGGTGCTAGTTCCCTCGGGG - Intronic
1104060032 12:125259855-125259877 TGGGGGTGCTGCCGCCCTCGTGG + Intronic
1111429943 13:88136720-88136742 TTGGGCTCCCAGCGCGCTCGGGG + Intergenic
1115515859 14:34184249-34184271 TAGGGGTTCTAATGACCTCGGGG + Intronic
1129234207 15:74214097-74214119 TAGGGGTCTCAGAGCCCTCAGGG + Intergenic
1135325671 16:21523908-21523930 GAGGGGTCCTGGAGCCCCCGAGG + Intergenic
1139923371 16:70473063-70473085 CTGGGGTCCCAGCTCCCTCGAGG - Exonic
1141726866 16:85795464-85795486 GTGGGGTCCTAGCGCCCCTGAGG - Intronic
1152707816 17:81854084-81854106 TAGGGGTCATAATGCCCTTGGGG + Intronic
934614709 2:95763953-95763975 GAGGGGTCCTACTGCCCTCCCGG - Intergenic
939035286 2:137123282-137123304 TAGGGGTCTTAGCTCCCTGTGGG + Intronic
949559506 3:5188402-5188424 TAACGGCCCTGGCGCCCTCGGGG - Intronic
960948173 3:122981258-122981280 TGTGGGTCCTAGGCCCCTCGGGG + Intronic
988665976 5:33328019-33328041 TAGGGGATCTAGCGCCATCGGGG - Intergenic
1005809254 6:29503679-29503701 CAGGGCTCCCAGGGCCCTCGAGG - Intergenic
1016821301 6:148348913-148348935 AAGGGATCCTACCGCCTTCGGGG - Intronic
1019314644 7:378929-378951 TGGGGGTCCTGGCGCCTGCGGGG - Intergenic
1023914949 7:44581910-44581932 CAGGGGGCCTGGCGTCCTCGGGG + Intronic
1032279793 7:130491557-130491579 TAGGGCGCATAGGGCCCTCGTGG + Intronic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1061235428 9:129339483-129339505 GAGGGGTCCTTGAGCCCTAGTGG + Intergenic
1061271642 9:129547111-129547133 GAGGGGTCCTGGGGCCCTCTGGG - Intergenic