ID: 904005164

View in Genome Browser
Species Human (GRCh38)
Location 1:27359813-27359835
Sequence CCTCATCTGCTGAGGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904005164_904005179 24 Left 904005164 1:27359813-27359835 CCCGCCACCCTCAGCAGATGAGG 0: 1
1: 0
2: 1
3: 45
4: 344
Right 904005179 1:27359860-27359882 TTATGTCCCTGTGCACGATGTGG 0: 1
1: 0
2: 1
3: 3
4: 76
904005164_904005174 -6 Left 904005164 1:27359813-27359835 CCCGCCACCCTCAGCAGATGAGG 0: 1
1: 0
2: 1
3: 45
4: 344
Right 904005174 1:27359830-27359852 ATGAGGGCGGGCCAGCCCCAGGG 0: 1
1: 0
2: 2
3: 15
4: 159
904005164_904005173 -7 Left 904005164 1:27359813-27359835 CCCGCCACCCTCAGCAGATGAGG 0: 1
1: 0
2: 1
3: 45
4: 344
Right 904005173 1:27359829-27359851 GATGAGGGCGGGCCAGCCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904005164 Original CRISPR CCTCATCTGCTGAGGGTGGC GGG (reversed) Intronic
900635896 1:3664796-3664818 CCGCATCTGGTAAGGGTGGCTGG - Intronic
900640113 1:3684504-3684526 CCTCCAGTGCTCAGGGTGGCTGG - Intronic
900659360 1:3774979-3775001 CCTCGTCTCTTGAGGGTGGCAGG + Intronic
900660119 1:3777966-3777988 CCTCCCCTGCTGGGGCTGGCAGG - Intergenic
901430615 1:9211806-9211828 CCTCATGTGCTGAGGCTCGAAGG - Intergenic
901674130 1:10872997-10873019 CCTCCTCTGCTGATTGAGGCTGG + Intergenic
902771374 1:18647150-18647172 CCTCGTCTGCTGAGCTTGGCTGG + Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
905106682 1:35567344-35567366 GCTCATCTGCTGAAGCTTGCAGG - Intergenic
905482876 1:38273639-38273661 CATCAGCCGCTGGGGGTGGCTGG + Intergenic
905803683 1:40861563-40861585 CGTGAGCTGCTGAGGGCGGCCGG - Exonic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905873635 1:41418745-41418767 ACTCCTCTGCTGGGGGTGGAGGG + Intergenic
906683919 1:47750422-47750444 CCTCATACCCTGAGGATGGCTGG + Intergenic
907639421 1:56171120-56171142 CCAGATCTACTGAAGGTGGCTGG + Intergenic
908967407 1:69782543-69782565 ACACAGCTGCTGAGTGTGGCTGG + Intronic
909042527 1:70671064-70671086 ACTCCTCTGGTGAGGGGGGCTGG - Intergenic
912227131 1:107746658-107746680 CCGCACCTGCCGAGGGAGGCTGG - Intronic
913371383 1:118103435-118103457 CCTCTGCTGCTGAGGAAGGCTGG - Intronic
913937124 1:125065377-125065399 CCTCATCTGTTGAGGCAGGCAGG + Intergenic
914880571 1:151543541-151543563 CCTCATCTGCTTAGTTTAGCTGG - Intronic
915570301 1:156741685-156741707 CATCACCAGCTAAGGGTGGCAGG + Intergenic
918038677 1:180898994-180899016 CCTCATCTGGACATGGTGGCTGG - Intergenic
918643815 1:186878636-186878658 CCTCATCTGCTTAGAATGTCAGG + Intronic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
920184606 1:204152121-204152143 CCTCAGCTGCCGGCGGTGGCTGG - Intergenic
920293833 1:204943731-204943753 CCACATGTGCTGAGTGTGCCTGG - Intronic
921842958 1:219847608-219847630 CCTGCTCTGCTGTGGGTGGTAGG - Intronic
923234446 1:232019110-232019132 CATCATCTGGTGAGGGAGACAGG + Intronic
924161240 1:241234540-241234562 CTTCATCCACTCAGGGTGGCTGG - Intronic
1063390017 10:5643926-5643948 CCTCGTCTGTGGAGCGTGGCAGG - Intronic
1064557911 10:16566248-16566270 TATCATCTTCTGAGGGTGACAGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067914462 10:50381692-50381714 GCTCATTTGCTGAGTGTGGTTGG - Intronic
1068556486 10:58464712-58464734 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1069906406 10:71735042-71735064 TCTCATCCTCTGAGGATGGCAGG - Intronic
1073841916 10:107507407-107507429 CTTCATCTGGTGAGGGTGTCGGG - Intergenic
1075103280 10:119520494-119520516 ACTCTTCTGTTGAAGGTGGCGGG - Intronic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1078569033 11:12441730-12441752 CCAAATCTGCTGAGGGAGGCAGG + Intronic
1082697488 11:56387473-56387495 CATCTGCTGCTGATGGTGGCAGG + Intergenic
1084493322 11:69489859-69489881 CCTCACCCGCTGAGAGTGTCGGG - Intergenic
1084549426 11:69832186-69832208 CCTCAGCTGCTGAGAATTGCAGG - Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085816342 11:79741357-79741379 CCACGTCTTCTGATGGTGGCAGG - Intergenic
1086399249 11:86447261-86447283 CCTCTTCTGCTGGTGGTGGTGGG + Intronic
1086869306 11:92017829-92017851 CCTGCTCTGGTGAAGGTGGCAGG + Intergenic
1087637593 11:100719943-100719965 CCTCCCCTGCTGAATGTGGCTGG + Intronic
1088733306 11:112703290-112703312 CCCCATGTGTTGAGGGAGGCAGG + Intergenic
1090957975 11:131530629-131530651 CCACATGAGCTGAGGCTGGCAGG - Intronic
1093469129 12:19482293-19482315 CCTGCTCTGCTGGAGGTGGCAGG + Intronic
1093488681 12:19681063-19681085 CCTCTTCTGGTGGAGGTGGCAGG + Intronic
1095038981 12:37421901-37421923 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1095049058 12:37541281-37541303 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1095049447 12:37543472-37543494 CCACATCTGCTAAGGCAGGCAGG - Intergenic
1095322401 12:40845646-40845668 TCTCATCTCCAGAGGCTGGCGGG - Intronic
1095777283 12:46024058-46024080 CCAGCTCTGATGAGGGTGGCAGG + Intergenic
1096255438 12:50059256-50059278 ACTCCTCTGCTGTGAGTGGCAGG - Intronic
1096576960 12:52558875-52558897 GTTCATCTGCTGAGGAGGGCTGG - Intergenic
1097201193 12:57280267-57280289 TCTCTTGTGCTGTGGGTGGCAGG - Intronic
1098095204 12:66947088-66947110 CCCCATCACCTGAGGGAGGCAGG + Intergenic
1098245465 12:68512710-68512732 CCCCATGTGTTGAGGGAGGCAGG + Intergenic
1098687021 12:73434594-73434616 CATCTTATGCTGATGGTGGCAGG + Intergenic
1101491168 12:105210984-105211006 TGTCATTTGCTGAGGGTAGCAGG - Intronic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1103184635 12:118945927-118945949 CCTCATCTAAAGGGGGTGGCAGG - Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1106477492 13:30110986-30111008 CCTCATCTGTTCAGTGTGGCTGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1109508362 13:63336649-63336671 CCTGTTCTGGTGAAGGTGGCAGG + Intergenic
1111160886 13:84393710-84393732 CCTATTCTGGTGAAGGTGGCAGG + Intergenic
1112087048 13:96042128-96042150 CCTGCTCTGCTGGAGGTGGCAGG - Intronic
1112601408 13:100859056-100859078 TCCCAGCTTCTGAGGGTGGCTGG - Intergenic
1113759373 13:112836995-112837017 CGTGACCTGCTGAGGGTGGGGGG - Intronic
1118787142 14:69055260-69055282 ACTCATCTACTGTGGGAGGCGGG + Exonic
1119323555 14:73745496-73745518 GCTCCTCTGGTGGGGGTGGCAGG - Intronic
1122114868 14:99522637-99522659 CCCCATCTGCTGCCGATGGCTGG - Intronic
1122128171 14:99590388-99590410 CCCCATCAGCTGAGGGTTTCTGG - Intronic
1122255170 14:100471136-100471158 TCTCTGCTGCTGAGGGTGGTTGG + Intronic
1122281925 14:100628743-100628765 CCTCTTCTGCTGAGTGTCACTGG - Intergenic
1123774567 15:23565972-23565994 CCTCCTCTGCGGAGGTGGGCAGG - Exonic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1127655217 15:61049067-61049089 CCACATCTGCTGAAGTTGACTGG + Intronic
1128154871 15:65385899-65385921 CCTCCACGTCTGAGGGTGGCGGG + Exonic
1128773503 15:70301512-70301534 GCTCATTTGCTGACTGTGGCAGG - Intergenic
1128946634 15:71827411-71827433 ACCCATTTTCTGAGGGTGGCAGG - Intronic
1130910337 15:88266326-88266348 GGGCATGTGCTGAGGGTGGCAGG + Intergenic
1131446167 15:92499622-92499644 CCACATCTGCTCCGGGTGGAGGG - Intronic
1131692997 15:94846405-94846427 CCTCACCTGCTGGGGTTGGGGGG - Intergenic
1132112138 15:99109404-99109426 CCTTAGCTGCTGAGGCTGACTGG + Intronic
1132750330 16:1454685-1454707 CCCCGGGTGCTGAGGGTGGCAGG - Intronic
1133026610 16:2991429-2991451 CCCCACCAGGTGAGGGTGGCTGG + Intergenic
1133039016 16:3050053-3050075 CCTGACGTGCTGGGGGTGGCGGG + Exonic
1134033980 16:11015576-11015598 GCTCATCTGCTGACTGTGGTGGG + Intronic
1134165712 16:11927681-11927703 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134495022 16:14726128-14726150 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134495045 16:14726256-14726278 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500406 16:14765248-14765270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500429 16:14765376-14765398 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526946 16:14951860-14951882 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526969 16:14951988-14952010 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134545469 16:15104560-15104582 TATCATCCGCTGAGGGTGGAAGG + Intronic
1134580151 16:15363674-15363696 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134580185 16:15363871-15363893 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134714512 16:16350268-16350290 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714534 16:16350394-16350416 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714556 16:16350522-16350544 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134722387 16:16393632-16393654 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722409 16:16393758-16393780 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722431 16:16393886-16393908 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134811241 16:17168720-17168742 CCTCAGTTGCTCATGGTGGCTGG - Intronic
1134944996 16:18317983-18318005 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945018 16:18318111-18318133 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945040 16:18318237-18318259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134952260 16:18358136-18358158 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952282 16:18358264-18358286 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952304 16:18358390-18358412 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1135266102 16:21027021-21027043 CCTCACCTGCTCACAGTGGCTGG + Exonic
1135310926 16:21404063-21404085 GATCATCCGCTGAGGGTGGAAGG + Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135311051 16:21404786-21404808 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311075 16:21404924-21404946 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311084 16:21404981-21405003 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311094 16:21405038-21405060 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311104 16:21405095-21405117 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135363876 16:21836500-21836522 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364002 16:21837237-21837259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364026 16:21837375-21837397 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364036 16:21837432-21837454 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364046 16:21837489-21837511 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364056 16:21837546-21837568 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135447786 16:22533802-22533824 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447796 16:22533859-22533881 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447806 16:22533916-22533938 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447815 16:22533973-22533995 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447839 16:22534111-22534133 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135447939 16:22534710-22534732 GATCATCCGCTGAGGGTGGAAGG - Exonic
1136257543 16:29052248-29052270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1136307775 16:29383896-29383918 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307800 16:29384034-29384056 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307810 16:29384091-29384113 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321131 16:29485093-29485115 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321170 16:29485326-29485348 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321195 16:29485464-29485486 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321205 16:29485521-29485543 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321214 16:29485578-29485600 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321224 16:29485635-29485657 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435746 16:30224685-30224707 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435851 16:30225296-30225318 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435876 16:30225434-30225456 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435885 16:30225491-30225513 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435894 16:30225548-30225570 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435904 16:30225605-30225627 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136573792 16:31111587-31111609 CCTCAGCTGCTGACAGAGGCAGG - Intronic
1137022417 16:35441840-35441862 ACAAATCTACTGAGGGTGGCAGG + Intergenic
1138105954 16:54287187-54287209 CCTAAGCTGCTGAAAGTGGCCGG - Intergenic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1141479946 16:84299806-84299828 CCTGTCCTGCTGAGGGGGGCTGG + Intronic
1141964373 16:87431936-87431958 CCTCAGCTGCTGAGGTTTGGAGG - Intronic
1144539856 17:16130374-16130396 CCTCAACTCCACAGGGTGGCTGG + Intronic
1144679644 17:17184402-17184424 CCTCCTCAGCTGAGGCTGTCAGG + Intronic
1144777468 17:17791979-17792001 CCTCACCTGCTGAGGTGGGGAGG + Intronic
1145378947 17:22376633-22376655 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145379426 17:22379003-22379025 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145379904 17:22381373-22381395 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145380384 17:22383748-22383770 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145380863 17:22386095-22386117 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145381342 17:22388470-22388492 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382075 17:22392244-22392266 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382550 17:22394609-22394631 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382830 17:22395972-22395994 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145383403 17:22398795-22398817 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145383917 17:22401263-22401285 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145384355 17:22403465-22403487 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145384674 17:22404927-22404949 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145385456 17:22409000-22409022 CCACATTTGCTGAGGCAGGCAGG - Intergenic
1147184853 17:38707550-38707572 GCTCATCTGCTGAGGTCAGCAGG + Intronic
1147427772 17:40354493-40354515 CCTCATCTGCGGAGGTGGGCAGG + Exonic
1148180354 17:45600753-45600775 CCTCATCCCCTGGCGGTGGCAGG + Intergenic
1148268546 17:46245141-46245163 CCTCATCCCCTGGCGGTGGCAGG - Intergenic
1149076837 17:52605731-52605753 GCACCTCTGCTCAGGGTGGCAGG + Intergenic
1149655636 17:58308427-58308449 CCACCTCTGCTGATGGAGGCAGG + Intronic
1152032849 17:77854583-77854605 CACCTTCTGCTGAGGGGGGCGGG - Intergenic
1152711436 17:81872075-81872097 CCTCATCTGCTCACGGTGCCAGG - Intergenic
1152806243 17:82357625-82357647 CCTAACCTGGTGGGGGTGGCAGG + Intergenic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1154088859 18:11337222-11337244 ACACATCTTCTGAGGGTTGCTGG + Intergenic
1155976412 18:32136515-32136537 CTTCAGCTGCTGTGGGTAGCGGG - Intronic
1156893314 18:42215211-42215233 CCTCCTCTGGTGGAGGTGGCAGG + Intergenic
1157444771 18:47736493-47736515 CCTCACCTGCTGGGGATGGGAGG - Intergenic
1157676333 18:49571436-49571458 GCTTTTCTCCTGAGGGTGGCAGG + Intronic
1158452480 18:57579558-57579580 CCTCTTCTGTTGCTGGTGGCTGG - Intronic
1163132795 19:15286206-15286228 TCTCATCTGCTCGGGGTGGAGGG - Intronic
1163722679 19:18905748-18905770 CCTCCTCTGCTGGGCGGGGCTGG - Intronic
1164840823 19:31390909-31390931 TCACAGATGCTGAGGGTGGCAGG + Intergenic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
1165476158 19:36032306-36032328 CCTCCTCTCCTCGGGGTGGCGGG + Exonic
1165595661 19:37009744-37009766 CCTCATCTGGTGAGGCAGGCAGG - Intronic
1166890249 19:45987389-45987411 CTGCATCTGCTGAACGTGGCCGG + Intergenic
1168060606 19:53889983-53890005 TCTCATCTGCTGTGGGAGCCCGG - Exonic
1168527946 19:57103706-57103728 CCCCAAATGCTGAGGGTGCCAGG - Intergenic
1168651711 19:58096385-58096407 CTTCATTTGCTGAGGCTGGGGGG - Intronic
1168724130 19:58571338-58571360 CCTCATCTTCTGGGGGTGCTCGG + Exonic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925281367 2:2687552-2687574 CCTGATCAGCTGGGGGTGACAGG - Intergenic
925389312 2:3484596-3484618 CGCCATCTTCTGATGGTGGCAGG + Intronic
925663967 2:6233177-6233199 CATCTTCTTCTCAGGGTGGCAGG + Intergenic
925925384 2:8666399-8666421 TCTCATCTTCCGAGGGGGGCAGG + Intergenic
926523143 2:13942956-13942978 CTTCATCTTTTGGGGGTGGCGGG - Intergenic
926612604 2:14961514-14961536 CTGCATCTGCTGAGGGTTTCAGG - Intergenic
926652954 2:15366579-15366601 GCTGAGCTGCTGAGGGTTGCAGG - Exonic
926918182 2:17913640-17913662 CTTCATCTGCTGACAGGGGCTGG - Intronic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
927553538 2:24017826-24017848 CCTCCTCTGCTCCAGGTGGCTGG - Intronic
928175930 2:29034366-29034388 CCTCATGTCCTCAGGGTGACAGG + Intronic
929388793 2:41443249-41443271 CCACAGCTGTTGAGGGTGGCGGG + Intergenic
929620210 2:43347073-43347095 CCTCATCTGATGGTGGAGGCAGG + Intronic
929819467 2:45261698-45261720 CCTCATCTGCTGAAGGCTCCCGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930173886 2:48281498-48281520 CCTCATGTGCTCAGGGAGACAGG - Intergenic
934560180 2:95309149-95309171 CCTCTCCTGCTCGGGGTGGCAGG - Intronic
935717995 2:105955357-105955379 CCTCCTGTGCTGTGGGTGGAAGG - Intergenic
937307960 2:120883921-120883943 ACTCATCTGCTGCGGGGGTCTGG - Intronic
938337442 2:130511980-130512002 CCTCCTCTGCTGAGGGAGCCAGG - Intergenic
938352396 2:130608755-130608777 CCTCCTCTGCTGAGGGAGCCAGG + Intergenic
938836918 2:135113520-135113542 CCTCAGCTGCTGTGACTGGCTGG - Intronic
941917880 2:170823849-170823871 CCTGGCCTGCTGAGGGTGGGGGG + Intronic
942233515 2:173881878-173881900 GCTCATCAGCTTAGGGTGGGGGG - Intergenic
943446670 2:187995245-187995267 CCAGCTCTGATGAGGGTGGCAGG - Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
1169397856 20:5250701-5250723 CCTGTTCTGGTGAAGGTGGCAGG + Intergenic
1170117216 20:12873225-12873247 CCTCATTTGCTGATGGTAGCAGG - Intergenic
1170177594 20:13489559-13489581 CACCATCTGCTGAGGACGGCAGG + Intronic
1170562581 20:17569933-17569955 CCTCATCTGCTGAAGGCTGCGGG - Exonic
1170931696 20:20774402-20774424 CCTCATCTCCTGACAGTGCCGGG + Intergenic
1171524178 20:25796650-25796672 CCACATCTGCTGAGGCAGGCAGG + Intronic
1171531464 20:25856166-25856188 CCACATCTGTTGAGGCAGGCAGG + Intronic
1171532229 20:25860339-25860361 CCACATCTGCTGGGGCAGGCAGG + Intronic
1171532882 20:25863665-25863687 CCACATCTGGTGAGGCAGGCAGG + Intronic
1171533314 20:25866166-25866188 CCACATCTGGTGAGGCAGGCAGG + Intronic
1171543594 20:25984784-25984806 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1171543978 20:25986987-25987009 CCACATCTGCTAAGGCAGGCAGG - Intergenic
1171552649 20:26059233-26059255 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1171807040 20:29689453-29689475 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1173062834 20:39678770-39678792 TTTCATTTGCTGAGGTTGGCTGG + Intergenic
1173614062 20:44391218-44391240 CCTCAGGTGGTGCGGGTGGCAGG - Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174505765 20:51016509-51016531 CCTCTTCAGCTTAGGGTGGTTGG - Intronic
1174858820 20:54070769-54070791 CCTCACCTACTGAGGCTGCCGGG + Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176682302 21:9825705-9825727 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176682582 21:9827114-9827136 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176683140 21:9829930-9829952 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176683419 21:9831340-9831362 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176683978 21:9834152-9834174 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176685115 21:9839786-9839808 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1176742338 21:10616130-10616152 ACTCATCTGTTGATGGTGGGTGG + Intergenic
1179042544 21:37816710-37816732 CCGCCTCTGCTGAGTGTGGATGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180001685 21:44998080-44998102 CCCCATCTTCTGAGGGTGGGAGG + Intergenic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1180039917 21:45270655-45270677 CCTGCTCTGCTGGAGGTGGCGGG - Intronic
1181179218 22:21055409-21055431 GCTGCTCTGCTGAAGGTGGCTGG + Intronic
1181634444 22:24168069-24168091 CCTCACAAGCTGAGGCTGGCAGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184668473 22:46000823-46000845 CATCATCTGCCCAGGGTGGAAGG - Intergenic
1184894886 22:47401103-47401125 CACTATCTGCTGAGCGTGGCTGG + Intergenic
950162160 3:10768563-10768585 TCTCTTCTGCTCAGGCTGGCAGG + Intergenic
953642482 3:44722160-44722182 TCTCATATGCTGAGTGAGGCAGG - Exonic
954322926 3:49844229-49844251 GCTCAGCTGCTGAGTTTGGCTGG - Intronic
955490396 3:59476256-59476278 CCTCATCTGATGAGTATGTCTGG + Intergenic
961312278 3:126010646-126010668 CATCATCTCCTGTGGCTGGCAGG + Intronic
961383704 3:126512239-126512261 CCTCCTCTGCTGAGGTTGCCAGG - Intronic
961697073 3:128712756-128712778 CCTCATGAGCTCAGTGTGGCAGG + Intergenic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
964527572 3:157631370-157631392 CCCTGTCAGCTGAGGGTGGCAGG - Intronic
964970463 3:162553687-162553709 CCTCATGTGTTGAGGGAGGGAGG - Intergenic
965435406 3:168644464-168644486 CCTCATGAGATGAGTGTGGCTGG - Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968285448 3:197505913-197505935 ACTCACCGGCTGAGAGTGGCCGG + Intergenic
968746376 4:2362652-2362674 CCAGATCTGCTGCCGGTGGCTGG - Intronic
969134390 4:5018830-5018852 CCTCATCTGCTGAGGGACCCGGG - Intronic
969476351 4:7424587-7424609 CCTCACCTCCTCATGGTGGCAGG + Intronic
969715063 4:8864366-8864388 CCTGAGCAGCTCAGGGTGGCTGG + Intronic
972082874 4:35175354-35175376 ACTCATCTGCTCAGGGATGCAGG + Intergenic
972113950 4:35604265-35604287 CCTCATCTGCTGAGATTAACAGG + Intergenic
975374917 4:73632259-73632281 CCAGCTCTGATGAGGGTGGCAGG - Intergenic
975812938 4:78188431-78188453 GCTCATCTGATGATGGAGGCTGG + Intronic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
977347360 4:95834058-95834080 CCTCTTCTGCTGAGATTAGCAGG + Intergenic
979664366 4:123294203-123294225 CCAGCTCTGATGAGGGTGGCAGG + Intronic
981076255 4:140595371-140595393 CCAGCCCTGCTGAGGGTGGCTGG + Intergenic
982022837 4:151221409-151221431 CCTGCTCAGCTGAGGATGGCAGG + Intronic
982106520 4:152016205-152016227 CGGCATCTGATGAGGGTGGAAGG - Intergenic
982171610 4:152667127-152667149 CCCCATCTGCTGTGTGTGGAAGG + Intronic
983752833 4:171298382-171298404 CCTCATTTCCTGGGGCTGGCAGG - Intergenic
984113041 4:175643925-175643947 CCGCATGTGCAGTGGGTGGCCGG - Intronic
984639067 4:182143660-182143682 CCTTTTCTGCTGCGGGTGGCGGG - Intergenic
985667370 5:1188037-1188059 CCACAGCTGCTGAAGCTGGCGGG - Intergenic
985707617 5:1410559-1410581 CTCCAGCTGCTGGGGGTGGCGGG - Intronic
986722510 5:10569800-10569822 CCTCTTCTGCTGACCGTGGTGGG + Intronic
990811619 5:59731376-59731398 GCCCATATGCTGAGGATGGCTGG + Intronic
994904375 5:105817879-105817901 CCTCATGTGCTGAGGAAGTCAGG - Intergenic
995038481 5:107562006-107562028 CCTCAACTGCCAAGGGTGGCAGG - Intronic
996031857 5:118714377-118714399 CCTGTTCTGCTGGAGGTGGCAGG - Intergenic
997351270 5:133233145-133233167 CCCCAGCTGCTGAGCGTGACTGG + Intronic
997480526 5:134180980-134181002 CCTCTACTGCTCAGGGAGGCAGG - Intronic
997528467 5:134568219-134568241 CCTCATCTGCTCAGCAGGGCTGG - Intronic
997755622 5:136396390-136396412 CATCATCTGCTGTTGGTGGATGG - Intronic
998399580 5:141841603-141841625 CTGCATCTGCTGGGGCTGGCTGG + Intergenic
998676903 5:144419541-144419563 CCTCTTCTGCTGCTGGAGGCAGG + Intronic
1000341358 5:160279582-160279604 CCTCACCTGCTGAGGGCAGTGGG + Intronic
1000511565 5:162189910-162189932 CCTTTTCTGGTGAAGGTGGCAGG + Intergenic
1001287645 5:170435471-170435493 CCTCATCTGGAGAGCGGGGCTGG + Intronic
1001436496 5:171703389-171703411 CCTCAGCACATGAGGGTGGCGGG + Intergenic
1002680475 5:180959191-180959213 CCAGCTCTGATGAGGGTGGCAGG + Intergenic
1003964682 6:11241781-11241803 CCTCAGCTGATGAGGGCAGCGGG - Intronic
1004235551 6:13872174-13872196 CCTCATTTCCTGGGGCTGGCAGG + Intergenic
1004503449 6:16228846-16228868 GCTCATCTGCTCGGGCTGGCAGG - Intergenic
1007387122 6:41527830-41527852 CCTCATGTCCTGAGTGTGGGTGG - Intergenic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1013495039 6:110689708-110689730 CCAAGTCTGATGAGGGTGGCCGG - Intronic
1013614567 6:111829932-111829954 CCTCATCTTCTGAGGCCAGCTGG - Intronic
1014003822 6:116394885-116394907 CATCAGCTGCTGAGAGTCGCTGG + Intronic
1017537673 6:155365699-155365721 CCTCCTCTGTGTAGGGTGGCAGG + Intergenic
1018911123 6:168101363-168101385 CCTCATCTGGTGGCGGCGGCTGG + Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019647603 7:2139402-2139424 CCTTCACTGCTGAGGGTGGGGGG - Intronic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1021857093 7:24867582-24867604 CATCATCTGTGGATGGTGGCAGG - Intronic
1023037843 7:36148585-36148607 TCTCATGTCCTGTGGGTGGCTGG + Intergenic
1024283848 7:47740134-47740156 CCTCCTCTGCAGAGGGGGCCTGG + Intronic
1025284601 7:57651550-57651572 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1025294969 7:57769855-57769877 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1025295356 7:57772066-57772088 CCACATCTGCTAAGGCAGGCCGG - Intergenic
1025301366 7:57821688-57821710 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1027793930 7:82668410-82668432 CCTCCTCTTCACAGGGTGGCAGG + Intergenic
1030362134 7:108606358-108606380 CTTCATCTGCTGAAAGTGGGGGG - Intergenic
1031693421 7:124818567-124818589 CCTCATCTGCTGCTGGAGTCTGG - Intergenic
1032739530 7:134724842-134724864 CCTCCTCTTCTGAGGTTGGATGG + Intergenic
1034971495 7:155422511-155422533 CCTCATTTTCTGAGGGTCTCTGG - Intergenic
1035338218 7:158143644-158143666 CCTCATCAGGTGAGTGGGGCAGG + Intronic
1036578156 8:10047932-10047954 CCCCATCTTCTGAGGTGGGCAGG + Intergenic
1037061047 8:14509946-14509968 CCTCACCTGTTGAGGGAGGGAGG - Intronic
1037799932 8:22027201-22027223 CCTCATGCACTGAGGGTGGAGGG + Intronic
1037818778 8:22125584-22125606 CCGCACTTGCTGAGAGTGGCAGG + Exonic
1037990837 8:23320246-23320268 CCCCAGCTGCTTAGGGTGCCTGG - Intronic
1042728966 8:71910212-71910234 CCTGATCTGGTAAAGGTGGCAGG + Intronic
1043463634 8:80485767-80485789 TGTCATTTGCTGAGGGTGGGTGG - Exonic
1049282239 8:141755604-141755626 CCTGGTCAGCTGAGGGTTGCAGG + Intergenic
1049287779 8:141785853-141785875 ACTCAGTTGCTGCGGGTGGCAGG + Intergenic
1049424241 8:142530995-142531017 CCCGATCTGCTGCGGCTGGCAGG - Intronic
1049963352 9:756984-757006 CCTCATTTGCTGAGGTTGAGAGG + Intergenic
1050773465 9:9233213-9233235 GCACCTCTTCTGAGGGTGGCAGG + Intronic
1051600165 9:18864591-18864613 CATCTTCTGCTGAGGGTGCGAGG + Intronic
1052301745 9:26959735-26959757 AGTCATCTGCTGAGAGTGGCAGG + Intronic
1052599604 9:30608233-30608255 CCCCATTTGTTGAGGGTGGGAGG + Intergenic
1053784309 9:41643621-41643643 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1053784926 9:41646726-41646748 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1054172266 9:61853754-61853776 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054173651 9:61860671-61860693 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1054447123 9:65382781-65382803 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054448506 9:65389736-65389758 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1054663889 9:67720110-67720132 CCACATCTGGTGAGGCAGGCAGG - Intergenic
1054665271 9:67727051-67727073 CCACATCTGGTGAGGCAGGCAGG + Intergenic
1057240235 9:93401167-93401189 CCGCCTTTGCAGAGGGTGGCAGG + Intergenic
1059563468 9:115358426-115358448 CCTCATGTGTTGAGGGAGGGAGG + Intronic
1062070230 9:134551433-134551455 CCTCACCTGCGGAGGATGCCAGG - Intergenic
1062156453 9:135051495-135051517 CCTCGGCTGCTGATGCTGGCTGG - Intergenic
1062243729 9:135552842-135552864 CCTCTTCTGCTGATGGACGCAGG + Intergenic
1062271959 9:135713923-135713945 CCTCACCTGGTGACAGTGGCAGG + Intronic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1203669772 Un_KI270754v1:39518-39540 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1186344261 X:8675333-8675355 CTTTCTCTGCTGAGCGTGGCAGG - Intronic
1186526654 X:10255293-10255315 CCCCATTTGATTAGGGTGGCTGG + Intergenic
1189382203 X:40509982-40510004 CCTCATCCCCTAAGGGTGGCAGG - Intergenic
1190253862 X:48747911-48747933 CCTAAACTGCTGAGGCTGACTGG - Intergenic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1190516611 X:51230204-51230226 CCTCATCTGTTGAGTGGGGCAGG - Intergenic
1192849813 X:74942829-74942851 CCCCATCTGGTGAGGGGGGATGG + Intergenic
1194439014 X:93906315-93906337 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1195247106 X:103004730-103004752 TCTGGGCTGCTGAGGGTGGCAGG + Intergenic
1196761444 X:119204209-119204231 CCCCAGCTGCTGAGGCTGGGAGG + Intergenic
1199586902 X:149424141-149424163 CCTGTTCTGGTGAAGGTGGCAGG - Intergenic
1199983804 X:152936319-152936341 CCTCATCATCTGTGGGGGGCAGG + Intronic