ID: 904008967

View in Genome Browser
Species Human (GRCh38)
Location 1:27379326-27379348
Sequence CTGACATCTCCTCCTGTCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 323}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904008967_904008973 24 Left 904008967 1:27379326-27379348 CCCAGGACAGGAGGAGATGTCAG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 904008973 1:27379373-27379395 TGCCCGCAGGAGCCAAAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 115
904008967_904008970 1 Left 904008967 1:27379326-27379348 CCCAGGACAGGAGGAGATGTCAG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 904008970 1:27379350-27379372 CATCAGACACTGAGCCTGCTTGG 0: 1
1: 0
2: 9
3: 50
4: 298
904008967_904008976 27 Left 904008967 1:27379326-27379348 CCCAGGACAGGAGGAGATGTCAG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 904008976 1:27379376-27379398 CCGCAGGAGCCAAAAACTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 139
904008967_904008971 11 Left 904008967 1:27379326-27379348 CCCAGGACAGGAGGAGATGTCAG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 904008971 1:27379360-27379382 TGAGCCTGCTTGGTGCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904008967 Original CRISPR CTGACATCTCCTCCTGTCCT GGG (reversed) Exonic