ID: 904008970 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:27379350-27379372 |
Sequence | CATCAGACACTGAGCCTGCT TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 358 | |||
Summary | {0: 1, 1: 0, 2: 9, 3: 50, 4: 298} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904008967_904008970 | 1 | Left | 904008967 | 1:27379326-27379348 | CCCAGGACAGGAGGAGATGTCAG | 0: 1 1: 0 2: 3 3: 32 4: 323 |
||
Right | 904008970 | 1:27379350-27379372 | CATCAGACACTGAGCCTGCTTGG | 0: 1 1: 0 2: 9 3: 50 4: 298 |
||||
904008968_904008970 | 0 | Left | 904008968 | 1:27379327-27379349 | CCAGGACAGGAGGAGATGTCAGG | 0: 1 1: 0 2: 1 3: 23 4: 286 |
||
Right | 904008970 | 1:27379350-27379372 | CATCAGACACTGAGCCTGCTTGG | 0: 1 1: 0 2: 9 3: 50 4: 298 |
||||
904008966_904008970 | 6 | Left | 904008966 | 1:27379321-27379343 | CCAGGCCCAGGACAGGAGGAGAT | 0: 1 1: 0 2: 3 3: 31 4: 326 |
||
Right | 904008970 | 1:27379350-27379372 | CATCAGACACTGAGCCTGCTTGG | 0: 1 1: 0 2: 9 3: 50 4: 298 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904008970 | Original CRISPR | CATCAGACACTGAGCCTGCT TGG | Exonic | ||