ID: 904008970

View in Genome Browser
Species Human (GRCh38)
Location 1:27379350-27379372
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 9, 3: 50, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904008967_904008970 1 Left 904008967 1:27379326-27379348 CCCAGGACAGGAGGAGATGTCAG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 904008970 1:27379350-27379372 CATCAGACACTGAGCCTGCTTGG 0: 1
1: 0
2: 9
3: 50
4: 298
904008968_904008970 0 Left 904008968 1:27379327-27379349 CCAGGACAGGAGGAGATGTCAGG 0: 1
1: 0
2: 1
3: 23
4: 286
Right 904008970 1:27379350-27379372 CATCAGACACTGAGCCTGCTTGG 0: 1
1: 0
2: 9
3: 50
4: 298
904008966_904008970 6 Left 904008966 1:27379321-27379343 CCAGGCCCAGGACAGGAGGAGAT 0: 1
1: 0
2: 3
3: 31
4: 326
Right 904008970 1:27379350-27379372 CATCAGACACTGAGCCTGCTTGG 0: 1
1: 0
2: 9
3: 50
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type