ID: 904008971

View in Genome Browser
Species Human (GRCh38)
Location 1:27379360-27379382
Sequence TGAGCCTGCTTGGTGCCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904008967_904008971 11 Left 904008967 1:27379326-27379348 CCCAGGACAGGAGGAGATGTCAG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 904008971 1:27379360-27379382 TGAGCCTGCTTGGTGCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 111
904008966_904008971 16 Left 904008966 1:27379321-27379343 CCAGGCCCAGGACAGGAGGAGAT 0: 1
1: 0
2: 3
3: 31
4: 326
Right 904008971 1:27379360-27379382 TGAGCCTGCTTGGTGCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 111
904008968_904008971 10 Left 904008968 1:27379327-27379349 CCAGGACAGGAGGAGATGTCAGG 0: 1
1: 0
2: 1
3: 23
4: 286
Right 904008971 1:27379360-27379382 TGAGCCTGCTTGGTGCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904008971 Original CRISPR TGAGCCTGCTTGGTGCCCGC AGG Exonic