ID: 904008976

View in Genome Browser
Species Human (GRCh38)
Location 1:27379376-27379398
Sequence CCGCAGGAGCCAAAAACTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904008968_904008976 26 Left 904008968 1:27379327-27379349 CCAGGACAGGAGGAGATGTCAGG 0: 1
1: 0
2: 1
3: 23
4: 286
Right 904008976 1:27379376-27379398 CCGCAGGAGCCAAAAACTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 139
904008967_904008976 27 Left 904008967 1:27379326-27379348 CCCAGGACAGGAGGAGATGTCAG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 904008976 1:27379376-27379398 CCGCAGGAGCCAAAAACTGGCGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904008976 Original CRISPR CCGCAGGAGCCAAAAACTGG CGG Exonic