ID: 904009996

View in Genome Browser
Species Human (GRCh38)
Location 1:27383866-27383888
Sequence CACAGCGGATGAGGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904009996_904010009 17 Left 904009996 1:27383866-27383888 CCTTCTGCCCCTCATCCGCTGTG 0: 1
1: 0
2: 1
3: 16
4: 278
Right 904010009 1:27383906-27383928 ACACCCTCTGGCCAGGTCAGGGG 0: 1
1: 0
2: 4
3: 20
4: 209
904009996_904010003 5 Left 904009996 1:27383866-27383888 CCTTCTGCCCCTCATCCGCTGTG 0: 1
1: 0
2: 1
3: 16
4: 278
Right 904010003 1:27383894-27383916 CTCTGGCCTACCACACCCTCTGG 0: 1
1: 2
2: 0
3: 13
4: 214
904009996_904010004 10 Left 904009996 1:27383866-27383888 CCTTCTGCCCCTCATCCGCTGTG 0: 1
1: 0
2: 1
3: 16
4: 278
Right 904010004 1:27383899-27383921 GCCTACCACACCCTCTGGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
904009996_904010008 16 Left 904009996 1:27383866-27383888 CCTTCTGCCCCTCATCCGCTGTG 0: 1
1: 0
2: 1
3: 16
4: 278
Right 904010008 1:27383905-27383927 CACACCCTCTGGCCAGGTCAGGG 0: 1
1: 1
2: 2
3: 18
4: 205
904009996_904010007 15 Left 904009996 1:27383866-27383888 CCTTCTGCCCCTCATCCGCTGTG 0: 1
1: 0
2: 1
3: 16
4: 278
Right 904010007 1:27383904-27383926 CCACACCCTCTGGCCAGGTCAGG 0: 1
1: 0
2: 0
3: 23
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904009996 Original CRISPR CACAGCGGATGAGGGGCAGA AGG (reversed) Intergenic
900613626 1:3554692-3554714 CACAGGAGAGGAGGGGCAGGGGG - Intronic
901042634 1:6374579-6374601 CATGGTGGATGAGGGGCAGGTGG + Intronic
901676420 1:10888607-10888629 CACAGCAGAAGAGGGGCAGGAGG + Intergenic
901882827 1:12204115-12204137 CACAGAGCAGAAGGGGCAGAGGG - Intronic
902699698 1:18163346-18163368 GACAGAGGATGAGTTGCAGAAGG + Intronic
903642124 1:24867406-24867428 TACAGCGGGTGAGGAACAGAAGG + Intergenic
904009996 1:27383866-27383888 CACAGCGGATGAGGGGCAGAAGG - Intergenic
904266001 1:29318920-29318942 CACAGCGGTTAAGAGGGAGATGG + Intronic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
905471079 1:38192377-38192399 CACAGAGGATGAGGGTCATTAGG - Intergenic
910200113 1:84690466-84690488 CGCAGCGGAGGAGGGGCCGCGGG - Exonic
910394055 1:86774285-86774307 GAAAGGGGAGGAGGGGCAGATGG - Intergenic
911210976 1:95137646-95137668 AAGAGGGGATGAGGGGAAGAAGG - Intronic
911678282 1:100684012-100684034 AACATGGGATGAGGGGCACACGG + Intergenic
912623914 1:111192329-111192351 CACAGAGGATGAGAGTCAGGGGG + Intronic
913205483 1:116534499-116534521 CCCAGCGGAGGAGGCGTAGAGGG - Intronic
914683744 1:149959760-149959782 CACAGAAGATGAATGGCAGAAGG - Exonic
915315962 1:155029471-155029493 CACACCTGATTAGGGGCAGGAGG - Intronic
917670808 1:177271704-177271726 CACAGAGCATGAGAGGCAGCAGG - Intronic
919746865 1:201014290-201014312 CCCAGCGGGTCAGGGGCAGGGGG - Intronic
921566449 1:216727418-216727440 CACAGCTCATGAGGAGTAGAAGG - Intronic
922056799 1:222049776-222049798 CACAGCGCTTGAGGGCCAGCTGG + Intergenic
924518075 1:244782608-244782630 CACAGGGGATGGGGGTCAGCAGG - Intergenic
1063960534 10:11301974-11301996 CTGAGCGGAGGAGGGGCAGGCGG - Intronic
1067045773 10:42984446-42984468 CACAGCTGGTGAGGGGGAGCTGG + Intergenic
1067170207 10:43899691-43899713 CACAGCACATGAGGCCCAGAAGG - Intergenic
1067186254 10:44030368-44030390 CCCACCTGACGAGGGGCAGATGG - Intergenic
1067845950 10:49721455-49721477 CACGGTGGGTCAGGGGCAGAGGG + Intergenic
1068591254 10:58855368-58855390 CACAGGGGATGAGGGGAACCAGG - Intergenic
1069592743 10:69652192-69652214 CACAGGGGATGCAGGGCACAGGG - Intergenic
1070238483 10:74655067-74655089 CAGAGCGGATGAAGGGAAGGCGG - Intronic
1070284163 10:75071452-75071474 CACAGTAGATGAGGGGCTTAGGG - Intergenic
1070555878 10:77527443-77527465 CACAGGGGGAGAGGGGAAGAAGG + Intronic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1070834222 10:79437863-79437885 CACAGCAGGTGAGGGGTAGCAGG + Intronic
1072526110 10:96272906-96272928 GACAGAGGAGGAGGGGGAGAAGG + Intergenic
1072806217 10:98425450-98425472 CACAGCAGCTGAGGGGCCAATGG - Intronic
1074086941 10:110215372-110215394 CACAGAGCATCAGGGCCAGAAGG + Intronic
1075738479 10:124678847-124678869 CACACCGAATGATGGCCAGAGGG + Intronic
1075808080 10:125204551-125204573 CACAGCCAGTAAGGGGCAGAGGG - Intergenic
1075808094 10:125204612-125204634 CACAGCCAGTAAGGGGCAGAGGG - Intergenic
1076799160 10:132812645-132812667 CACAGAGGGTGGGGGGCAGGAGG + Intronic
1077020633 11:415744-415766 CAGAGCAGATGAGGGGCAGATGG + Intronic
1077601998 11:3580755-3580777 CACAGCCGAGAAGGGGCAGCTGG + Intergenic
1078448214 11:11420893-11420915 CACAGCTGACCAGGGGAAGAAGG + Intronic
1081103582 11:39035642-39035664 CACATCGTATGAGGGGAAAAAGG + Intergenic
1081810129 11:45909810-45909832 CCCTGCGGAGAAGGGGCAGACGG + Exonic
1081848916 11:46261183-46261205 CATAGCAGATAAGTGGCAGAAGG - Intergenic
1082263802 11:50098332-50098354 CACAGCAGGTGAGCAGCAGATGG - Intergenic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083627082 11:64077390-64077412 CACAGCTGGGGAGGGACAGAGGG - Intronic
1083664685 11:64268099-64268121 AACAGCGGCTTGGGGGCAGAGGG - Intronic
1084257905 11:67955301-67955323 CACAGCCGAGAAGGGGCAGCTGG + Intergenic
1084651482 11:70491940-70491962 CACATGGGATGTGGGACAGACGG + Intronic
1084774792 11:71368253-71368275 CACAGCTGGCGAGGGGCAGCAGG - Intergenic
1084814857 11:71639936-71639958 CACAGCCGAGAAGGGGCAGCTGG - Intergenic
1085279131 11:75318923-75318945 CACATGGGAGTAGGGGCAGAAGG + Intronic
1087606588 11:100384592-100384614 CAAAGCTGATCAGGGGCTGAAGG + Intergenic
1089628794 11:119770534-119770556 CACAGAGGAGGAAGGGCAGAGGG + Intergenic
1090386908 11:126362638-126362660 CCCAGGGGAAGAGGGGCAGGTGG + Intronic
1091024121 11:132126817-132126839 CACAGCAAAGGAGGGGCAGCTGG - Intronic
1091080142 11:132658623-132658645 CTCAGCGGCTAAAGGGCAGATGG - Intronic
1091296808 11:134479684-134479706 AACAGCAGAAGAGTGGCAGAGGG + Intergenic
1091977490 12:4837077-4837099 CACAAGGGGTGAGGGGCTGAAGG + Intronic
1092148464 12:6230885-6230907 CACGACGGATGTGGGGGAGAAGG + Intronic
1092242713 12:6845382-6845404 CAGAGCGGGCGAGGGGCATAGGG + Intronic
1092428140 12:8390098-8390120 CACAGCCGAGAAGGGGCAGCTGG + Intergenic
1092763669 12:11832645-11832667 GAGAGAGGATGAGGAGCAGATGG - Intronic
1093221626 12:16427279-16427301 AACAGGGGATGAAGGGCAGAGGG + Intronic
1094596988 12:31874741-31874763 CACAGGAGATGCAGGGCAGATGG + Intergenic
1094641733 12:32282481-32282503 CAAAGTGGATGAGTGGGAGAAGG + Intronic
1096575808 12:52552223-52552245 CCCAGCGGATCAGGAGCAGCAGG - Intronic
1097572714 12:61355059-61355081 CACAGGGGATGGGGGTCACAGGG - Intergenic
1097573164 12:61357154-61357176 AACAGGGGATGTGGGGCACAGGG + Intergenic
1098881982 12:75926490-75926512 CACAGAGGATTGGGGGCAGGAGG + Intergenic
1101687937 12:107044160-107044182 CAGAGCAGCTGTGGGGCAGATGG - Intronic
1103909085 12:124342067-124342089 GGCAGCGGCTGCGGGGCAGAGGG + Exonic
1104214417 12:126722129-126722151 CACAGGGGATGTGGGTCAAAGGG + Intergenic
1104888258 12:132124777-132124799 CCCAGAGGATGAGGGGCTGTGGG + Intronic
1105902495 13:24768030-24768052 CACAAAGGTTGAGGGGCAGGGGG - Intronic
1105947006 13:25198602-25198624 CACATTGGATGGGAGGCAGAGGG - Intergenic
1108570104 13:51741260-51741282 TACACAGGATGAAGGGCAGAAGG + Intronic
1108648388 13:52452117-52452139 CACAGGGGCAGAGGGACAGAGGG + Intergenic
1108787460 13:53921691-53921713 CACACGGGATGCGGGGCACAGGG + Intergenic
1109187807 13:59291534-59291556 CACAGAGGATGAGCGGAAGCAGG + Intergenic
1109194268 13:59360696-59360718 CAGAGCAAATGAGTGGCAGAAGG - Intergenic
1110543751 13:76734052-76734074 CACAGCGGGTGGGGGGCGGTGGG + Intergenic
1115102249 14:29716453-29716475 TACAGAGGAGGAGGGGAAGAAGG + Intronic
1116882568 14:50186061-50186083 AACATAGGATGAGGGGCAAAAGG + Intronic
1116997552 14:51339679-51339701 CAGAGTGGATAAGGGCCAGAGGG - Intergenic
1118438073 14:65789533-65789555 CAGAGGGGAAGAGGGGAAGAGGG - Intergenic
1121104437 14:91271210-91271232 CACAGAGGAAGGGGAGCAGAGGG + Intergenic
1122476730 14:102015290-102015312 CAAAGAGGATGAGGGGGAGGAGG + Exonic
1123068045 14:105628036-105628058 CACAGGGGAGGAGGGGCAGGTGG - Intergenic
1123774452 15:23565456-23565478 CACAGCGAAGCAGAGGCAGAAGG + Intergenic
1124622359 15:31280980-31281002 GACAGCACATGAGGGGCAGCTGG - Intergenic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1126749264 15:51860064-51860086 CAAAGCAGAGGAGGGCCAGAAGG - Intronic
1127559501 15:60121873-60121895 CACAGTAGTTGGGGGGCAGAGGG - Intergenic
1128209594 15:65886108-65886130 GAGAGAGGATGAGGGGGAGAAGG + Intronic
1128910943 15:71514177-71514199 CACAGCAGCTGGGGAGCAGAAGG + Intronic
1129331505 15:74830213-74830235 CACAGAGGAGGAGGAGGAGAAGG + Exonic
1130257564 15:82332844-82332866 CCCAGGGGATGAGGACCAGATGG + Intergenic
1130546382 15:84859776-84859798 CGCAGGGGATGAGGGGCCGGCGG + Exonic
1130597380 15:85257120-85257142 CCCAGGGGATGAGGACCAGATGG - Intergenic
1131562264 15:93454981-93455003 CACAGCGCAGGAGGGACAGGAGG + Intergenic
1132695467 16:1199849-1199871 GGAAGCGGATGAGGGGCAAAGGG - Intronic
1133370093 16:5240272-5240294 CACAGCCGAGAAGGGGCAGCTGG - Intergenic
1133461301 16:5988938-5988960 CACAGCAGATGCAGGACAGAGGG - Intergenic
1134322271 16:13174679-13174701 CACATGGGGTGAGGTGCAGAGGG + Intronic
1134845944 16:17440566-17440588 CACAGTTCATTAGGGGCAGAGGG - Intronic
1137313058 16:47285860-47285882 CACAGATGATCAGAGGCAGAGGG - Intronic
1138659046 16:58507170-58507192 CACACCCTGTGAGGGGCAGAGGG + Intronic
1140832376 16:78763958-78763980 CACAATAGATGTGGGGCAGAGGG - Intronic
1141260146 16:82445471-82445493 CACAGCAGATGAAGGAGAGAAGG - Intergenic
1141665906 16:85465015-85465037 CACAGCTAGTGAGGTGCAGACGG + Intergenic
1141725620 16:85786555-85786577 CACAGCGGGGGAGGGGGAGGTGG + Intronic
1141884317 16:86881297-86881319 CACAGCTGGTGAGGGCCAAATGG - Intergenic
1141985566 16:87577503-87577525 CCCAGTGGATGAGTGGGAGAGGG - Intergenic
1142684888 17:1571993-1572015 CCTGGAGGATGAGGGGCAGACGG + Intronic
1142856172 17:2731562-2731584 CAGTGAGGAGGAGGGGCAGAGGG - Intergenic
1142964499 17:3572270-3572292 CAGAGGAGCTGAGGGGCAGAGGG + Intronic
1143724063 17:8833240-8833262 AATAGCGTGTGAGGGGCAGAGGG - Intronic
1145304658 17:21666832-21666854 CACAAAGGATGAGGGGCCCAGGG - Intergenic
1148161091 17:45450575-45450597 CCCAGCTGCTGAGGGACAGAGGG - Intronic
1148546469 17:48522907-48522929 AACAGTGGATGAGGGCCAGGAGG + Intergenic
1148612207 17:48971953-48971975 CACAGGGGATGGGGGTCAGGAGG + Intergenic
1150227900 17:63533742-63533764 CAGAGGGGATGAGGGAGAGATGG - Intronic
1150392325 17:64797221-64797243 CCCAGCTGCTGAGGGACAGAGGG - Intergenic
1151433896 17:74082311-74082333 CACAGCTCATTAGTGGCAGAGGG + Intergenic
1152566064 17:81100972-81100994 CTCAACAGATGACGGGCAGAGGG - Intronic
1152568109 17:81109179-81109201 CACAGGGGAGGGGGGGCGGATGG - Intronic
1152570647 17:81119927-81119949 CACAGCGGAAGAGGGTGAGCAGG - Exonic
1152988649 18:342558-342580 CCCAGAGGATGAAGGGCAGATGG - Intronic
1153545926 18:6204695-6204717 CAAAGATGCTGAGGGGCAGATGG - Intronic
1153675224 18:7451104-7451126 CACAGCTGATGTGCGGCTGAAGG + Intergenic
1154342122 18:13512219-13512241 CACAGCAGATGTGTGGCTGAGGG - Intronic
1155964818 18:32025823-32025845 CAAAAAGGAGGAGGGGCAGAAGG + Intronic
1156513327 18:37659940-37659962 GACAGAGTATGAGGGACAGAGGG + Intergenic
1156697529 18:39784725-39784747 CCCAGCAGATGAAAGGCAGATGG + Intergenic
1157543969 18:48534918-48534940 CACAGCAGGAGAGGGGCAGGTGG + Intergenic
1157613789 18:48975515-48975537 CACGGCGGCGGAGGGGCCGAGGG + Intergenic
1160102375 18:75934994-75935016 CACAGGGGCTCAGGGTCAGAAGG + Intergenic
1160323097 18:77914698-77914720 CCCAGCAGTTGATGGGCAGAGGG + Intergenic
1161774530 19:6252181-6252203 CACAGAGGGAGAGAGGCAGATGG - Intronic
1163190260 19:15672402-15672424 CACAGGGGATGAGGCTGAGAGGG - Intergenic
1164713759 19:30376917-30376939 CACAGTGGGTACGGGGCAGATGG + Intronic
1166365361 19:42275480-42275502 CACAGCCTAGGAGGGGAAGAGGG + Intronic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1168008343 19:53509212-53509234 CACAGAGGAAGGAGGGCAGATGG - Intergenic
925196643 2:1931192-1931214 CACGGCAGATGAGGAGCAGAGGG - Intronic
925294434 2:2768057-2768079 CACAGGTGAGGAGGGGCGGAGGG - Intergenic
925407165 2:3613306-3613328 CACAGGGGATGCGGGAGAGAAGG + Exonic
926073975 2:9925516-9925538 CACAGCTAATGGGTGGCAGAGGG + Intronic
926242926 2:11101767-11101789 CAGAGAGGATCAGGGGCTGAGGG + Intergenic
926332903 2:11839823-11839845 CCCTGCTGATGAGGTGCAGAAGG - Intergenic
926903592 2:17785143-17785165 CACGGATGATGAGGGGGAGATGG - Exonic
926921223 2:17942155-17942177 CACAGATCATGAGGGGAAGAGGG - Intronic
928217080 2:29370766-29370788 CACAGGGGAAGTGGGCCAGAAGG - Intronic
929930578 2:46252637-46252659 CACAGGGGAAGAGGTGCAGCTGG - Intergenic
933266616 2:80187700-80187722 CAGAGAGAAAGAGGGGCAGATGG + Intronic
934128182 2:88919806-88919828 CAGAGGGGCAGAGGGGCAGAGGG - Intergenic
934128185 2:88919814-88919836 CAGAGAGGCAGAGGGGCAGAGGG - Intergenic
934777388 2:96948207-96948229 CACAGGGAGCGAGGGGCAGAGGG - Intronic
934810366 2:97272032-97272054 CTCAGCGGACCAGGGACAGAGGG + Intergenic
934827326 2:97435907-97435929 CTCAGCGGACCAGGGACAGAGGG - Intergenic
936092476 2:109510356-109510378 CACAGCAGATGCTGGGCAAAGGG + Intergenic
937109171 2:119349644-119349666 CAAAGAGGGTGAGGGGCGGAGGG - Intronic
937871754 2:126791291-126791313 CACAGGAGCTGAGGGGCTGAGGG - Intergenic
938239172 2:129729767-129729789 CACAGAGGCTGAGGAGCAGCTGG - Intergenic
938609772 2:132935587-132935609 CACACCGGATGAGAGGTGGAAGG + Intronic
941208264 2:162602239-162602261 CACAACAGATGAGAGGCAGAAGG + Intronic
942053698 2:172163228-172163250 CACAGGGGATGCGGGGCACAGGG + Intergenic
942335431 2:174879912-174879934 CACAGGGCATGAAGGGAAGATGG + Intronic
943881954 2:193157171-193157193 CATTGCTGATGAGGGTCAGAAGG - Intergenic
944474047 2:200085742-200085764 CACAGGGGCAGAGAGGCAGAGGG - Intergenic
945059183 2:205893540-205893562 CACAGCTGGTCAGTGGCAGAGGG + Intergenic
946193868 2:218021955-218021977 CAGAGCGGGGGAAGGGCAGAGGG + Intergenic
947999606 2:234557096-234557118 CACACCGGCAGAGGGGCAGGTGG + Intergenic
948109615 2:235444204-235444226 CACACCTGGGGAGGGGCAGAAGG + Intergenic
1169252430 20:4070985-4071007 CAGAGCAGAGGAGGGGCTGATGG + Intronic
1171008550 20:21492321-21492343 ACCAGAGGCTGAGGGGCAGAAGG + Intergenic
1172787875 20:37481107-37481129 CACAGTGGATGAGGGGAAGCAGG - Intergenic
1173810361 20:45951686-45951708 CACAGCAGGTGAGCGGCAGGTGG - Intronic
1174184987 20:48700003-48700025 CACACGGGATGAGGCGCAGATGG - Intronic
1175064772 20:56275444-56275466 CCCAGCGGAAGAGTGGCAGATGG + Intergenic
1175697567 20:61113937-61113959 CACCGCTGATGGGGGGCCGATGG - Intergenic
1175765313 20:61588371-61588393 CACAGCGGGAGAGAGGCACAAGG + Intronic
1176655974 21:9589268-9589290 CACAAAGGATGAGGGGCCCAGGG - Intergenic
1176901701 21:14450088-14450110 CACAGTGGATGAGAGTCATATGG - Intergenic
1180043546 21:45292587-45292609 CACAGCGAAGGAGGGGCTGGCGG + Intergenic
1181436750 22:22915598-22915620 CAGAATGGATGAGGGGCAGGAGG - Intergenic
1181503410 22:23333474-23333496 AAAAGGTGATGAGGGGCAGAAGG - Intergenic
1181653972 22:24279953-24279975 AAAAGGTGATGAGGGGCAGAAGG - Intronic
1181708401 22:24663704-24663726 AAAAGGTGATGAGGGGCAGAAGG - Intergenic
1182756248 22:32682056-32682078 CACGGGAGATGAGGGGCAGCAGG + Intronic
1183377370 22:37473020-37473042 CACAGCTAATATGGGGCAGAGGG - Intronic
1184405975 22:44301042-44301064 CACAGCGGGGGACGGGCAGGCGG + Intronic
950260029 3:11536815-11536837 CACAGCTGCTGAAGGGAAGATGG - Intronic
950735025 3:15000174-15000196 AACAGAGGCTGAGGGGCAGGGGG - Intronic
950889584 3:16391635-16391657 CATAGTGGATGAAGAGCAGAGGG + Intronic
954302444 3:49707054-49707076 CACAGAGCATGAGGGGTACAGGG - Intronic
954948339 3:54446401-54446423 CACAGGTGGTGAAGGGCAGAGGG + Intronic
956907690 3:73783415-73783437 AGCAGGGGATGAGGAGCAGAGGG + Intergenic
957326206 3:78698556-78698578 CACAACTGATGTGGGGAAGAAGG + Intronic
957426800 3:80050884-80050906 CACAGGGGATGCAGGGCACAGGG - Intergenic
961281235 3:125766968-125766990 CACAGCCGAGAAGGGGCAGCTGG - Intergenic
961378086 3:126480334-126480356 CACAGCGGAATTGGGGCAGCTGG - Intergenic
961625452 3:128259638-128259660 CACAGAGAATGAGGAGCAAAGGG - Intronic
961873140 3:130002617-130002639 CACAGCCGAGAAGGGGCAGCTGG + Intergenic
965357909 3:167699737-167699759 CATAGAGGATAAGGGGGAGAGGG + Intronic
969293410 4:6254915-6254937 CCCAGTGGAGGAGTGGCAGAGGG + Intergenic
969528026 4:7713938-7713960 CACAGCAGCTGAGGGGACGAGGG + Intronic
969737508 4:9001225-9001247 CACAGCCGAGAAGGGGCAGCTGG - Intergenic
971209437 4:24601636-24601658 CACTGCAGATGAGCGGCAGCTGG + Intergenic
974102843 4:57436871-57436893 CACAGGGCATGAGGGGTGGAGGG + Intergenic
974633148 4:64522079-64522101 AACAGAGGATGAGGGGAAGATGG - Intergenic
975793880 4:77984805-77984827 CAGAGGGGCAGAGGGGCAGAGGG + Intergenic
975793883 4:77984813-77984835 CAGAGGGGCAGAGGGGCAGAGGG + Intergenic
980645164 4:135634821-135634843 CACATGGGCTGAGGGGGAGATGG - Intergenic
980988630 4:139719017-139719039 CACAGGGCATGCTGGGCAGAGGG + Exonic
982626897 4:157778935-157778957 CCCAGAGGTTGAGGGGCACAAGG - Intergenic
983248949 4:165323598-165323620 CACAGCAGAGGAAGGGAAGAGGG + Intergenic
985198204 4:187455921-187455943 CAGAGTGTATGAGGGGCTGATGG + Intergenic
987005295 5:13704082-13704104 CCCAGCTGGTGAGGGGCATAAGG + Intronic
987588657 5:19893122-19893144 CTCAGAGGCAGAGGGGCAGAGGG - Intronic
988934296 5:36066945-36066967 CACGAGGGAGGAGGGGCAGAGGG - Intronic
994236502 5:97369241-97369263 CGCAGTGGTTGATGGGCAGATGG + Intergenic
994925337 5:106110464-106110486 CACATCAGATGTGGGGCATAAGG + Intergenic
998127990 5:139637355-139637377 CACAGCGGCTGAGGGGGGGGGGG - Intergenic
999623023 5:153491143-153491165 CTGATCGGATGAGGGGCAGAGGG + Intronic
1002297860 5:178241357-178241379 CAGAGGGGATGTGGGGAAGAGGG + Intronic
1002301704 5:178261042-178261064 CACAGCGGGGGAGGGGGATATGG + Intronic
1002534241 5:179867504-179867526 GACAGCAGAGGAGAGGCAGAGGG + Intronic
1002805237 6:567305-567327 CACAGAGGATGGGGGGAAGCAGG - Intronic
1003092549 6:3116247-3116269 CACAGCTGAGAAGGGGCAGGGGG - Intergenic
1003399378 6:5779148-5779170 CCCAGGGGATGAGGGGCATGTGG - Intergenic
1003735445 6:8873079-8873101 CACAGAGGATGAGAAGCAAAAGG - Intergenic
1004346558 6:14854631-14854653 CCCAGCGTATCAGGGACAGATGG + Intergenic
1006220253 6:32484044-32484066 CACAGGGGATATGGGGCACAAGG - Intergenic
1006297260 6:33175405-33175427 CTCAGCTGCTGATGGGCAGAGGG - Intronic
1006364876 6:33609556-33609578 CACCCTGGATGAGGGTCAGAAGG + Intergenic
1013419440 6:109952719-109952741 CACAGGGCCTGAGAGGCAGATGG - Intergenic
1013851646 6:114523240-114523262 CACAGCGGATGTGGGTGGGAGGG + Intergenic
1016792367 6:148079205-148079227 GACAGAGGATCAGAGGCAGAAGG - Intergenic
1017765761 6:157605799-157605821 CACAGCGGGTGGGGGGTAGGGGG + Intronic
1018769425 6:166957805-166957827 CACAGTGGATGGGGGACAGTCGG + Intergenic
1019485216 7:1286129-1286151 CTCAGGGTATGACGGGCAGAGGG + Intergenic
1019660148 7:2219636-2219658 CAGAGCGGTAGGGGGGCAGATGG + Intronic
1021487670 7:21184541-21184563 CACAGCCGGTGATTGGCAGAGGG - Intergenic
1024042683 7:45567477-45567499 CACAGAGGATGAGAGAAAGAAGG - Intergenic
1024965932 7:55021869-55021891 CACAGCTGGTGGGAGGCAGACGG + Intronic
1025019179 7:55467303-55467325 CACATGGGGTGAGGGGCAGGAGG + Intronic
1025302054 7:57825971-57825993 CACAAAGGATGAGGGGCCCAGGG + Intergenic
1026383168 7:69819584-69819606 CACAGTGGATCAGAGGCATATGG + Intronic
1027486719 7:78770745-78770767 CCCAGGGGTTGAGGAGCAGAAGG + Intronic
1030105366 7:105982556-105982578 CACAGGGACTGAGGGGGAGAAGG - Intronic
1034493835 7:151408847-151408869 CACAGCCAGTGAGGGGTAGATGG - Intronic
1034496454 7:151426192-151426214 CACAGGGGATGATGTGTAGAGGG + Intergenic
1034881999 7:154769930-154769952 CCCAGGGGACCAGGGGCAGATGG - Intronic
1035211540 7:157332319-157332341 CACAGAGGCTGCAGGGCAGAGGG - Intergenic
1035587135 8:785465-785487 CACAGGGGCTGAGGGGAGGAGGG - Intergenic
1035625635 8:1068681-1068703 CTCAGCGCATGTGGGACAGAGGG + Intergenic
1036242607 8:7092487-7092509 CACAGCCGAGAAGGGGCAGCTGG - Intergenic
1036830129 8:12014659-12014681 CACAGCCGAGAAGGGGCAGCTGG + Intronic
1036899213 8:12658951-12658973 CACAGCCGAGAAGGGGCAGCTGG + Intergenic
1037107715 8:15129841-15129863 CACAGAGGACGTGGAGCAGAAGG - Intronic
1037701375 8:21277358-21277380 CACAGGGGATGAGGGGAAAATGG - Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1047262555 8:123275094-123275116 GAGGGCGGCTGAGGGGCAGAGGG - Intronic
1048685266 8:136898036-136898058 CAAAGAGGATGTGGGGAAGAGGG + Intergenic
1048768981 8:137874868-137874890 CACAGTGGTTGAGGGGAGGATGG - Intergenic
1048817928 8:138351352-138351374 CACAGAGGCTGATGTGCAGAGGG + Intronic
1049850098 8:144826423-144826445 CAGAGAGGATGTGGGGCTGAGGG + Intergenic
1050296176 9:4207727-4207749 CACAGCTCATGAGTAGCAGATGG + Intronic
1051602658 9:18890374-18890396 GACAGAGGATGAGGTGCACAGGG - Intronic
1052251873 9:26408097-26408119 CAAAGCAAAAGAGGGGCAGAAGG + Intergenic
1055570759 9:77614725-77614747 CACAGCTGAAGTGGGGAAGAAGG - Intronic
1056197598 9:84243480-84243502 CATGTGGGATGAGGGGCAGAAGG - Intergenic
1057489445 9:95509968-95509990 GAAAGCGGCTGGGGGGCAGACGG - Intronic
1058757728 9:108099383-108099405 CACAGCAGAGGTGGGGCTGAGGG - Intergenic
1060155951 9:121319832-121319854 CACAGTGGAGAAGGGGAAGAGGG + Intronic
1060244127 9:121929772-121929794 CACAGCTGGAGAGGGGCAGAGGG - Intronic
1060409338 9:123389798-123389820 CTGAGCAGGTGAGGGGCAGAGGG + Intronic
1061034065 9:128103722-128103744 CACAGTGGAGGAGAGGCAGACGG + Exonic
1061326904 9:129869588-129869610 AGCAGCAGGTGAGGGGCAGAGGG - Intronic
1062142726 9:134968701-134968723 CACAGCCGAGGAGCAGCAGAGGG + Intergenic
1062266924 9:135690773-135690795 GACAGCTGATGAGGGTCAAAAGG + Intergenic
1062488526 9:136792850-136792872 CACAGAGGATTGGGGGCAGGAGG + Exonic
1203633691 Un_KI270750v1:92728-92750 CACAAAGGATGAGGGGCCCAGGG - Intergenic
1192180648 X:68913690-68913712 CAGAGAGGCCGAGGGGCAGAAGG + Intergenic
1193399665 X:81027568-81027590 CACAGCCCAGTAGGGGCAGACGG + Intergenic
1196414340 X:115454844-115454866 CACAGATGATGAAGGGCAGTGGG + Intergenic
1197664784 X:129211701-129211723 CACAGGGGATGAGGTGGTGAGGG + Intergenic
1200133787 X:153864977-153864999 CACAGTGGATGAGGGGGGCAAGG - Exonic