ID: 904011058

View in Genome Browser
Species Human (GRCh38)
Location 1:27390961-27390983
Sequence GGCCTCATGGGGTTGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904011058_904011064 10 Left 904011058 1:27390961-27390983 CCACTCAACAACCCCATGAGGCC No data
Right 904011064 1:27390994-27391016 TTATCCCTGTGTTTTAGATGAGG No data
904011058_904011067 17 Left 904011058 1:27390961-27390983 CCACTCAACAACCCCATGAGGCC No data
Right 904011067 1:27391001-27391023 TGTGTTTTAGATGAGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904011058 Original CRISPR GGCCTCATGGGGTTGTTGAG TGG (reversed) Intergenic