ID: 904012554

View in Genome Browser
Species Human (GRCh38)
Location 1:27398189-27398211
Sequence CAGGGGAAGAAGGATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1889
Summary {0: 1, 1: 0, 2: 9, 3: 199, 4: 1680}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904012542_904012554 21 Left 904012542 1:27398145-27398167 CCCAAAATGTAATATTACACAGT 0: 1
1: 1
2: 4
3: 56
4: 444
Right 904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG 0: 1
1: 0
2: 9
3: 199
4: 1680
904012543_904012554 20 Left 904012543 1:27398146-27398168 CCAAAATGTAATATTACACAGTG 0: 1
1: 0
2: 1
3: 28
4: 250
Right 904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG 0: 1
1: 0
2: 9
3: 199
4: 1680
904012548_904012554 -9 Left 904012548 1:27398175-27398197 CCTCAGAGAAAGAGCAGGGGAAG 0: 1
1: 1
2: 6
3: 60
4: 504
Right 904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG 0: 1
1: 0
2: 9
3: 199
4: 1680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904012554 Original CRISPR CAGGGGAAGAAGGATGGGGA GGG Intergenic
900078212 1:835062-835084 GATGGGCAGATGGATGGGGAGGG - Intergenic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900183179 1:1321316-1321338 CAGGGGAAGCTGGCGGGGGAGGG - Intronic
900205070 1:1428034-1428056 GAGGGGAAGAGGGGAGGGGAGGG + Intergenic
900205106 1:1428112-1428134 GAGGGGAAGAGGGGAGGGGAGGG + Intergenic
900296648 1:1955262-1955284 CAGGGCAGGAGGCATGGGGAGGG + Intronic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900751514 1:4400844-4400866 CAGAGAAAGAGGGATGGGGAAGG - Intergenic
900919773 1:5662783-5662805 CAGGGGCAGGAGGCAGGGGAGGG + Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901214845 1:7549423-7549445 CGGGGGAATAAGGATGAGGGAGG - Intronic
901217981 1:7565353-7565375 CAGGGGCAGAAGGCTGGTGAGGG + Intronic
901238602 1:7680360-7680382 GAGGGGAGGAGGGCTGGGGAAGG + Intronic
901522803 1:9798142-9798164 GAGGGGAAGAGGGAGGGGGAGGG + Intronic
901522812 1:9798160-9798182 GAGGGGAAGAGGGAGGGGGAGGG + Intronic
901644411 1:10708952-10708974 CAAGGGATGGAGGACGGGGAGGG + Intronic
901653347 1:10755568-10755590 CCAGGGAAGAGGGATTGGGAAGG - Intronic
901838536 1:11939345-11939367 GTGGGGATGAAGGATGGGGGAGG + Intronic
901849635 1:12007310-12007332 CGTGGGAAGAGAGATGGGGAAGG - Intronic
902408462 1:16199299-16199321 CAGGGGGAGGAGCATGGGTAGGG + Intronic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
902617655 1:17632594-17632616 CAGGGCAAGAGGGATGGGAGAGG - Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902754439 1:18539986-18540008 GAAGGGAGGAAGGAAGGGGAAGG + Intergenic
902785436 1:18730067-18730089 GAGGTGAAAAAGGAAGGGGAGGG + Intronic
902797134 1:18807224-18807246 CAGGGGAAGAGGCAGGGGGTAGG + Intergenic
903009913 1:20322407-20322429 GAGGGGGAGAAGCAAGGGGAAGG + Intronic
903325555 1:22566849-22566871 CAAGGGGACATGGATGGGGAAGG + Intronic
903333229 1:22608211-22608233 CAGGGGCAGAAGGGAGAGGAAGG - Intergenic
903515621 1:23909008-23909030 CAGTGGAAGCAGGTGGGGGAGGG + Intronic
903646612 1:24899948-24899970 CAGGGGATGGGGGATGGGGTAGG + Exonic
903679794 1:25089229-25089251 GAGTGGGAGCAGGATGGGGAGGG + Intergenic
903686331 1:25134970-25134992 CAGGGCAATGGGGATGGGGAGGG - Intergenic
903774430 1:25783593-25783615 CTGGGGAAGAAGGGTGGGCCTGG - Intronic
903850350 1:26301925-26301947 CCAGTGGAGAAGGATGGGGAAGG + Intronic
904005316 1:27360484-27360506 CAGGGTAGTAAGGGTGGGGAAGG - Intronic
904006483 1:27365958-27365980 CAGCGGGGCAAGGATGGGGAGGG - Intronic
904012554 1:27398189-27398211 CAGGGGAAGAAGGATGGGGAGGG + Intergenic
904087190 1:27917127-27917149 AAGGGGAAGGAGGAAGGAGAAGG - Intergenic
904087193 1:27917140-27917162 AAGAGGAAGGAGGAAGGGGAAGG - Intergenic
904128691 1:28260121-28260143 GAGGGGGAGAAGGAGGGAGAGGG - Intronic
904131800 1:28281044-28281066 CAGGGGAAGGAGGAAGGGTGTGG - Exonic
904263950 1:29307053-29307075 CAGGGGCAGATGGAGGTGGACGG - Intronic
904322344 1:29706099-29706121 CAGGGGAAAGATGATGGGAAGGG - Intergenic
904352397 1:29917293-29917315 GGGAGGAAGAAGGAAGGGGAAGG - Intergenic
904419406 1:30381974-30381996 CAGAGGAGGAAGCATGGGCAGGG + Intergenic
904468790 1:30723346-30723368 CACGGGATCCAGGATGGGGAAGG - Intronic
904581678 1:31548476-31548498 GAGGAGAAGAGGGATGGGGGTGG + Intergenic
904597174 1:31654166-31654188 CAGGGCAAGGAGTATGGGGGTGG + Intronic
904618665 1:31763089-31763111 CAGGGGTGGGAGGATAGGGATGG + Intronic
904698106 1:32341846-32341868 CAGGGGAAGGGGGAGGGGAAGGG - Intergenic
904941735 1:34168399-34168421 CAGGAGGAGGAGGATGGGGCTGG + Intronic
905051048 1:35051499-35051521 AAGGGCAAGAAGAATGGGAAAGG - Intergenic
905228063 1:36492869-36492891 CTGTGGCAGGAGGATGGGGATGG + Intergenic
905256471 1:36688566-36688588 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256492 1:36688620-36688642 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256513 1:36688674-36688696 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256612 1:36688944-36688966 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905256635 1:36689008-36689030 AAGGGGAAGGAGTATGGGAAGGG + Intergenic
905448076 1:38040328-38040350 GAGGGGAGGAGTGATGGGGATGG + Intergenic
905477781 1:38240995-38241017 AAGTTGAAGAAGGATGGGCAAGG + Intergenic
905680692 1:39869087-39869109 CATGGGGAGAGGGAGGGGGAGGG - Intronic
905921654 1:41723337-41723359 CAATGGGATAAGGATGGGGATGG - Intronic
905935123 1:41817377-41817399 CAGGGAAAAAAGGATGGGGCCGG + Intronic
906175434 1:43767308-43767330 CAGGGGAAGATGGATGTGGCTGG + Intronic
906191700 1:43903332-43903354 CAGGGCCTGAGGGATGGGGATGG - Intronic
906383014 1:45344838-45344860 CAGGGAAAGCAGGATGGGTGAGG - Exonic
906733758 1:48104985-48105007 CAGGGAGAAAAGGAAGGGGAGGG + Intergenic
907165975 1:52411700-52411722 AAAGGGAAGCAGGATGGTGAAGG - Intronic
907273578 1:53304725-53304747 CAGGGCCAGCAGTATGGGGATGG + Intronic
907343135 1:53751784-53751806 AACAGGAAGAAGGAAGGGGAGGG - Intergenic
907401138 1:54225675-54225697 CAGGGGAGGGAGGAAGGAGAAGG + Intronic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907574076 1:55510117-55510139 CAGGGACAGAAGGGTGGGGAAGG - Intergenic
907696069 1:56730401-56730423 GAGGGGAAGGAGGAGAGGGAGGG + Intronic
907734365 1:57097415-57097437 CAGGAGAAGAAGGAGCTGGAGGG + Intronic
907761815 1:57368343-57368365 GAGGGGCTGAAGGATGGGGGCGG + Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
907951748 1:59189897-59189919 CAGGGAAAGAAGAATGGAGAGGG - Intergenic
908333692 1:63097939-63097961 AAGGAAAAGAAGGATGGGGGAGG + Intergenic
908353160 1:63306231-63306253 GAGGAGAAGGAGGAAGGGGAAGG + Intergenic
908556291 1:65259789-65259811 GAGGGGTGGGAGGATGGGGAGGG + Intronic
908605813 1:65795780-65795802 CACCTGAGGAAGGATGGGGAAGG - Intronic
908783557 1:67713479-67713501 CAGGGAGAGCAGGGTGGGGATGG + Intronic
908792699 1:67798576-67798598 GAGGAGAAGGAGGAAGGGGAGGG - Intronic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909286523 1:73826916-73826938 GAGGGGAAGAAGGGAGGGTAGGG + Intergenic
909428021 1:75550378-75550400 CAGGGGCTGGAGGATGGGCATGG + Intronic
909713075 1:78674096-78674118 TAAGGGAAGAATGAAGGGGAAGG - Intergenic
910120342 1:83781675-83781697 CAGGCAAAGAGGGAAGGGGAAGG + Intergenic
910407435 1:86904179-86904201 CAGCAGAAGAAGGACGGGAAAGG + Intronic
910570331 1:88694278-88694300 CAGGGGATGGAGGAGAGGGAAGG - Intronic
910577430 1:88780936-88780958 CAGGGGAAGAAGGAACTGAAAGG - Intronic
910713176 1:90202902-90202924 CAGCAGAAGAATGATGGGGAAGG + Intergenic
910777701 1:90892536-90892558 GAGGGGGAGAGGGAGGGGGAGGG + Intergenic
910799771 1:91133422-91133444 CAGGAGAAAAAGGAGGGGAAAGG - Intergenic
911084176 1:93962894-93962916 GAGAGGGAGAAGGATTGGGAGGG - Intergenic
912127382 1:106555585-106555607 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912500261 1:110116980-110117002 CATGGGTAGAAGGAAGTGGAGGG + Intergenic
912548710 1:110470140-110470162 TAGGGGAAGAAGGAAGGGAAGGG - Intergenic
912634538 1:111279508-111279530 CAGGGGTAGAGGGCTGGGAAAGG + Intergenic
912807390 1:112768072-112768094 AGGGGGAAGGAGGTTGGGGATGG + Intergenic
912849245 1:113107377-113107399 GAGGGGAAGAAGGGTGGCCAGGG - Intronic
912959074 1:114179372-114179394 GAGAGGAAGAGGGATGAGGAAGG - Intergenic
913097189 1:115529597-115529619 CAGGTGGTGAAGGAAGGGGATGG + Intergenic
913283593 1:117208297-117208319 CAGGTGAAGAAGGGTGGAAAAGG - Intronic
913464286 1:119123781-119123803 GAGGGGAAGGAGGGAGGGGAGGG - Intronic
913705540 1:121418577-121418599 GAGGGGGAGGGGGATGGGGAGGG + Intergenic
914758523 1:150580041-150580063 CAGGGGTTGAAGGAAGAGGACGG + Intergenic
914824973 1:151133456-151133478 CAGGAGGAGTGGGATGGGGACGG + Exonic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915320869 1:155055867-155055889 CAGGGGGAGGAGGATGTGCAGGG - Intronic
915478479 1:156168898-156168920 CAGGGGAAGAGGGTTGGGTTTGG + Intronic
915545744 1:156596518-156596540 CAAGGGAATAGGGATGGTGATGG - Intronic
915662383 1:157415039-157415061 CAGTGGAGGATGGATGGGGTGGG - Intergenic
915719028 1:157970460-157970482 CAGGGGAAGAAAGAAGGGAATGG - Intergenic
915736548 1:158088979-158089001 CACGGGAAGCAGGGTGGGGTGGG + Intronic
915948417 1:160171178-160171200 CAGGGGCAAAAAGAAGGGGAAGG - Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916025256 1:160827950-160827972 AAGGGTGAGAAGGAGGGGGAGGG - Exonic
916332064 1:163628319-163628341 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916490764 1:165300403-165300425 AATGGGAAGAAGGATGGGTTAGG - Intronic
916577819 1:166082767-166082789 CAGAGGGAGTAAGATGGGGAAGG + Intronic
916706535 1:167356814-167356836 CAAGGGAAGAATCATGGGAAAGG - Intronic
916863971 1:168836742-168836764 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
917034304 1:170730172-170730194 GGGGAGGAGAAGGATGGGGAGGG - Intronic
917410609 1:174756642-174756664 CAGGGGAAAAAGGAAGGCGGAGG + Intronic
917470283 1:175320773-175320795 GAAGGAAAGAAGGAAGGGGAGGG - Exonic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917758718 1:178132020-178132042 GAAGGGAAGAAGGAGGGGAAGGG - Intronic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917802074 1:178580563-178580585 CTGAGGAGGAGGGATGGGGAGGG - Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918164737 1:181934377-181934399 GTGGGAAAGAAGGATGGAGAAGG + Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
918442718 1:184584086-184584108 CAGGGCTGGAAGGAGGGGGAAGG - Intronic
918568191 1:185955179-185955201 CAGTGGAAGATGGATTGGAATGG - Intronic
919920150 1:202162527-202162549 CAGGGGAAGAAGGAGTGGGCAGG - Intergenic
919925478 1:202189797-202189819 CAGGTAGAGAAGGCTGGGGATGG - Intergenic
920232689 1:204481053-204481075 CAGGGGGAAAAGTATGTGGAGGG - Intronic
920458275 1:206117194-206117216 GAGGGAAAGAAGGCTGGGGAGGG + Exonic
920494809 1:206447186-206447208 TAGGGGAAGAAGGGAGGGGGAGG - Intronic
920661151 1:207915960-207915982 CAGTTGCAGAAGGATTGGGAAGG - Intergenic
920671597 1:208007701-208007723 CAGGGGTGGAAGGACGAGGAAGG - Intergenic
920681557 1:208077008-208077030 CAGGGAAAGGAGGATGGGGTAGG + Intronic
921091047 1:211843414-211843436 GAGAGGAAGAAAGATGGGAATGG + Intergenic
921097016 1:211895452-211895474 AAGAGGAAGAGGGAAGGGGAGGG - Intergenic
921262294 1:213395028-213395050 CAGGGGAAGGAGGGTGGGAAAGG - Intergenic
921266462 1:213424805-213424827 GTAGGGAAGAAGGATGGGAAGGG - Intergenic
921343769 1:214160555-214160577 AAGGAGAAGAAGTATGGGTAGGG + Intergenic
921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG + Intronic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922367380 1:224878598-224878620 CAGGACCACAAGGATGGGGATGG + Intergenic
922403850 1:225291008-225291030 AAGGGAGAGAAGGATAGGGAGGG - Intronic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
922925021 1:229341497-229341519 CAGGCGAGGGAGGATGGGGAGGG + Intronic
922969829 1:229727128-229727150 CAATGTAACAAGGATGGGGATGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072424 1:230577859-230577881 AAGGGGAAGAAGGAGGGGAAGGG - Intergenic
923230819 1:231984601-231984623 CAGGGGTACAAGGATGAGTAAGG + Intronic
923253487 1:232198794-232198816 TTGGGGAAGAAGTATGTGGATGG - Intergenic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
923482499 1:234397558-234397580 GGGGGGAAGGGGGATGGGGATGG + Intronic
923940741 1:238822895-238822917 CAGGGGTTGAGGGAAGGGGAAGG + Intergenic
924240048 1:242031740-242031762 CAGGTTATGAGGGATGGGGAGGG + Intergenic
924829598 1:247579052-247579074 CTGGGGAAGAATTATGTGGATGG + Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063057044 10:2517030-2517052 AATGGAAAGAAGGAGGGGGATGG - Intergenic
1063385201 10:5612195-5612217 CAGTAGAAGCTGGATGGGGAAGG - Intergenic
1063505440 10:6593824-6593846 ACTGGGAAGAGGGATGGGGAGGG - Intergenic
1063759704 10:9058875-9058897 CAAGGGAAGAAGGAAAGAGAAGG - Intergenic
1063905127 10:10773799-10773821 CATGTGAAGAAGGAAGAGGAGGG - Intergenic
1063968990 10:11368154-11368176 CCAGGGAGGAAGGCTGGGGAGGG + Intergenic
1064076039 10:12269583-12269605 CGGGGGAAGGAGGGCGGGGAAGG - Intergenic
1064148176 10:12841778-12841800 GAGGGAAAGAAGGATGGAGTGGG - Intergenic
1064262718 10:13798939-13798961 CTGGGGAAGAAGGAAGGGAAAGG - Intronic
1064569675 10:16679765-16679787 CTAGGGCAGAAGGATGGTGATGG - Intronic
1065047048 10:21754188-21754210 CAGTTGAAGTAGGATGGGGTGGG - Intergenic
1065121133 10:22531325-22531347 AAGGGGGAGAAAGAGGGGGAGGG + Intergenic
1065149587 10:22808990-22809012 GAGGGCAAGAAGGATGGGAGTGG - Intergenic
1065204539 10:23344304-23344326 GATGGAAAGGAGGATGGGGAGGG + Intronic
1065318436 10:24486526-24486548 CAGTGAAGGAAGGAAGGGGAGGG - Intronic
1065546809 10:26829963-26829985 CAGGGTCCGGAGGATGGGGAGGG - Intronic
1065608528 10:27446665-27446687 AAGGGAAGGAAGGAAGGGGAAGG - Intergenic
1065696857 10:28388177-28388199 GAGGGGAAGGAGGAAGGGAAGGG + Intergenic
1065728755 10:28691665-28691687 GAGGGGAAGAGGGAGAGGGAGGG - Intergenic
1065753585 10:28910653-28910675 GAGGAGAAGAAGGGTTGGGAAGG - Intergenic
1065904467 10:30237871-30237893 CAGGGTCAGAAGGAAGGAGATGG + Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066356280 10:34687275-34687297 CAGGGCAAGGGGGCTGGGGAAGG + Intronic
1066357765 10:34701591-34701613 CACCGGAACAAGGATGGGAAGGG + Intronic
1066440215 10:35431364-35431386 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1067934979 10:50602490-50602512 CAGGGGAAGAAGGGAGAAGAAGG + Intronic
1067972266 10:50986181-50986203 CAGGGGAAGAGAGTAGGGGATGG - Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1067984865 10:51131623-51131645 CAGTGGAAGATGAATGTGGAAGG + Intronic
1068062471 10:52086183-52086205 CAGGGTGGAAAGGATGGGGAGGG - Intronic
1068269172 10:54697658-54697680 AAGGGGAAGGGGGAAGGGGAAGG + Intronic
1069027657 10:63561399-63561421 AAGAGGAAGAAAGATAGGGAGGG + Intronic
1069059869 10:63884254-63884276 CAGGGCAAGAAGGGTAGGGGTGG - Intergenic
1069293629 10:66815314-66815336 CTGGGGATGAAGGGAGGGGATGG - Intronic
1069606517 10:69742187-69742209 GAGGGAAAGGAGGCTGGGGAGGG + Intergenic
1069963895 10:72097601-72097623 CAGGAGAGGAGGGATGGGGGTGG + Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070405350 10:76089734-76089756 TAGGTGATGAAAGATGGGGAGGG - Intronic
1070463226 10:76690951-76690973 CATGGGGAGGAGGAGGGGGAGGG - Intergenic
1070655795 10:78270209-78270231 AAGGGGACCAAGCATGGGGATGG + Intergenic
1070729214 10:78813768-78813790 CAGGGGAGAGAGGAAGGGGAAGG - Intergenic
1070826875 10:79395990-79396012 AAGTGGGAGTAGGATGGGGAAGG - Intronic
1070923662 10:80204736-80204758 CTGGGGATCAAGGTTGGGGAAGG + Intronic
1071026265 10:81117632-81117654 CGGGGAAAGGAGGAAGGGGAGGG + Intergenic
1071204204 10:83255027-83255049 GAGGGGGAGAAGGGTGGGGGAGG - Intergenic
1071492276 10:86144008-86144030 TAGGGGAAGAAGGAACGGGTGGG - Intronic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071807683 10:89142542-89142564 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1071911114 10:90234879-90234901 CAGGGGGAAAAGGGTGGGAAGGG + Intergenic
1072195743 10:93116045-93116067 GAGGGGGAGGAGGAGGGGGAGGG + Intergenic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072425976 10:95331249-95331271 CAGGGAAATCAGGATGGGGTGGG - Intronic
1073119697 10:101113958-101113980 GAAGGAAAGAAGGAAGGGGAGGG + Intronic
1073127511 10:101160869-101160891 CAGAGGAAGATGGATGTGGCAGG - Intergenic
1073173549 10:101534527-101534549 GAGTGGGAGAAGGAAGGGGATGG - Intronic
1073178363 10:101569887-101569909 CGGGGAAAGAGGGATGGGGTGGG + Intergenic
1073338391 10:102727621-102727643 CAGGGGAGGAAGGAAGAGGTAGG - Intronic
1073339623 10:102735154-102735176 GAGGGGAGGAGGGATGAGGAGGG - Intronic
1073597715 10:104817394-104817416 AAGGGGGAGGAGGAGGGGGAAGG - Intronic
1073757809 10:106599388-106599410 GAGGAGGAGAAGGAAGGGGAGGG + Intronic
1073775829 10:106784999-106785021 CAAGGGATGAAGAATGTGGATGG - Intronic
1073832705 10:107404294-107404316 CCTGGGAAGAATGATGTGGAGGG - Intergenic
1074326289 10:112455148-112455170 GAGGGGAGGAGGGAAGGGGAGGG - Intronic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074856099 10:117474664-117474686 TAGGAGATGGAGGATGGGGATGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1074967491 10:118504261-118504283 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1075284476 10:121171766-121171788 GAGGGGAAGGAAGAAGGGGAAGG + Intergenic
1075723198 10:124599031-124599053 CAGGGATGGATGGATGGGGATGG - Intronic
1075855985 10:125630768-125630790 CAGTGGAAGTGGGAAGGGGAGGG - Intronic
1075923123 10:126229610-126229632 GAGGGGGAGAGGGAGGGGGAGGG - Intronic
1076344576 10:129771699-129771721 CAGGCAAGGAAGGGTGGGGAAGG + Intergenic
1076698177 10:132257038-132257060 CAGGAGCAGATGGATGGGCAGGG + Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077091265 11:779399-779421 GAGGGGAAGAGGAATGGGGAGGG - Intronic
1077093309 11:789145-789167 CAGGGGGAGGAGGGCGGGGAGGG + Intronic
1077269593 11:1669234-1669256 CACGGGAAGAGGGATGGGTGAGG + Intergenic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1077554056 11:3217606-3217628 CAGGTGCAGCAGGGTGGGGAGGG + Intergenic
1077801402 11:5542252-5542274 TAGGGCATGAGGGATGGGGAGGG - Intronic
1078106466 11:8361199-8361221 CAGGGCCAGAGGGAAGGGGAGGG + Intergenic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078234742 11:9473732-9473754 CAGGGGAGGAAGGATGGCTGAGG + Intronic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1078735689 11:14018477-14018499 CAGGGGCTGAAGGAAGGGGCTGG + Intronic
1078807954 11:14725505-14725527 GAAGGGGAGAAGGAGGGGGAAGG - Intronic
1079060496 11:17244619-17244641 CAAAGGAAGAAGGGTGGGGAGGG - Intronic
1079110717 11:17603611-17603633 CAGGAGAAGCAGTATGGGAAGGG - Intronic
1079129230 11:17737848-17737870 CAGGGGTAGAGGGCTAGGGAGGG + Intronic
1079206139 11:18416677-18416699 AAGGGGAAGATGGAAGGGAAGGG - Intronic
1079234060 11:18674900-18674922 CTGGGGAAGAAGGTTGCAGATGG - Intergenic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1079372185 11:19861030-19861052 CAGAGGGAGAGGGAGGGGGAGGG + Intronic
1079396166 11:20065706-20065728 CAGTGGCAGAGGCATGGGGAAGG + Intronic
1079934522 11:26600471-26600493 GAGGGGAAGAGGGGAGGGGAGGG - Intronic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080456906 11:32427017-32427039 GAGGGGAGGGAGGATGGGGATGG + Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080583624 11:33663269-33663291 CAGATGGAGAAGGATTGGGAGGG + Intronic
1080665775 11:34334645-34334667 CATGGGAAGAGGGAAAGGGAAGG - Intronic
1080966462 11:37219487-37219509 GAGGGGAAGAAAGAGTGGGAAGG - Intergenic
1081159037 11:39731478-39731500 CAGGGGAAGCATCATGGGAAAGG - Intergenic
1081567759 11:44270381-44270403 CAGGAGAAGAAGGAGGGAGGAGG - Intronic
1081569814 11:44282813-44282835 CAGGTGTAGGAGGAGGGGGAAGG + Intronic
1082674154 11:56075112-56075134 CTGTGGCAGGAGGATGGGGAGGG - Intergenic
1083106478 11:60363210-60363232 CAGGGAAAGATGGAAGAGGAAGG - Intronic
1083187700 11:61027034-61027056 CAAGTGCAGAAGGAGGGGGAGGG + Intergenic
1083215426 11:61215831-61215853 CAGGTGAGGATGGATGGGGCAGG - Intergenic
1083218310 11:61234660-61234682 CAGGTGAGGATGGATGGGGCAGG - Intergenic
1083224120 11:61273920-61273942 CGAGGGAAGAAGGGTGGGGCAGG - Intronic
1083287202 11:61667743-61667765 CTGGGTGAGAGGGATGGGGAGGG + Intergenic
1083347101 11:62001320-62001342 CAGGAGAGCAAGGCTGGGGAGGG - Intergenic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083715905 11:64576863-64576885 GAGGGGAATGAGGATGGGGCTGG - Intergenic
1083779477 11:64910510-64910532 CAGGGGAAGAGGGACAGGGCTGG + Intronic
1083784256 11:64934745-64934767 CAGGGGAGGAAGGAGGGGAGAGG + Exonic
1083857700 11:65401311-65401333 CTGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857712 11:65401337-65401359 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857718 11:65401350-65401372 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1083951383 11:65958506-65958528 CAAGGGAAAGAGGATGGGGAGGG + Intronic
1083959068 11:66003960-66003982 CAAGGGAAAAAGGACGGGGGAGG - Exonic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1084188216 11:67486540-67486562 CAGGGCAAGAGGGTTGGGGCTGG - Intronic
1084286977 11:68138153-68138175 GAGGGGAAGGAGGGAGGGGATGG + Intergenic
1084572496 11:69968080-69968102 CTTGGGATGAAGGATGGGGCTGG - Intergenic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084884288 11:72193368-72193390 AAGGGGAGGAAGGAAAGGGAGGG + Intronic
1084919061 11:72454441-72454463 CAGGGGAAGAATCATGTGGCTGG + Intergenic
1084934680 11:72580539-72580561 AAGGGGAAGAAGGACGGGGTGGG + Intronic
1084958711 11:72704753-72704775 CTGGGCAAGAGGGATGGGGGTGG + Intronic
1085474138 11:76778948-76778970 CAGGGGAAAAAGCATGGAGGTGG + Intergenic
1085502707 11:77038083-77038105 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1085596100 11:77811583-77811605 CAAGGGAAGGAAGATGGGGATGG + Intronic
1085697171 11:78714842-78714864 CACGGGGAGAAGGCTGGGGAAGG - Intronic
1085734205 11:79025072-79025094 CAGGGGAGGAAGGAAAGGGATGG + Intronic
1086089160 11:82987794-82987816 CAGGTGAAGAAGGATCAGGTTGG + Intronic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1087188530 11:95229955-95229977 AAGGGCGAGAGGGATGGGGAAGG - Intronic
1087487174 11:98770785-98770807 GAGGGGAAGGGGGAGGGGGAGGG + Intergenic
1087601330 11:100319706-100319728 CAGGGTGAGAATGATTGGGAGGG - Intronic
1088166970 11:106950579-106950601 CTGGTGAAGAAGGTGGGGGAGGG + Intronic
1088194808 11:107262565-107262587 TAGGGGATTGAGGATGGGGAAGG + Intergenic
1088713584 11:112529308-112529330 GAGGGAAAGAAGGCTGGTGATGG + Intergenic
1088735332 11:112723744-112723766 AAGGGGAGGGAGGATGGGCAGGG + Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089084512 11:115805746-115805768 CTGGTGAAGATGGGTGGGGAGGG - Intergenic
1089165470 11:116472788-116472810 CAGGGGAGGAGGGAGGGAGAAGG - Intergenic
1089173872 11:116534740-116534762 CAGGGTAAGGAGGAATGGGAAGG + Intergenic
1089293013 11:117449887-117449909 GAGGGAAGGGAGGATGGGGATGG - Intronic
1089308850 11:117544613-117544635 GAGAGGAAGAAGGATGGGCCTGG - Intronic
1089369443 11:117944603-117944625 CACGGAAAGAAGGACGAGGAAGG + Intergenic
1089375106 11:117988510-117988532 AAAGGGAAGAGGGAGGGGGAGGG + Intronic
1089459052 11:118642123-118642145 AAGAGGAAGAAGGAAGGGGAAGG - Intronic
1089603933 11:119630768-119630790 CAGGGGCAGAAGGAAGGGGAAGG + Intronic
1089624676 11:119743487-119743509 CAGGTGAGGGAGGAGGGGGAAGG - Intergenic
1089705900 11:120277379-120277401 CAGGGTTAGAAGGAGGTGGAGGG - Intronic
1089744943 11:120610060-120610082 CAGGAGAAGGCAGATGGGGAGGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090241907 11:125189814-125189836 CAGGGAAGGAAGGAGAGGGAGGG - Intronic
1090391777 11:126393466-126393488 CAGGAGGAGGGGGATGGGGACGG + Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090670443 11:128941807-128941829 CAGGGGAAGGTGGGTGGGGGCGG - Intronic
1090703226 11:129314789-129314811 GAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1090744187 11:129693639-129693661 AAGGGGAAGAGGGAAGGGAAGGG + Intergenic
1091197877 11:133747359-133747381 CTGGGTGAGAAGGATGGGGGTGG - Intergenic
1091310764 11:134573706-134573728 CAGAGGAGGCAGGAAGGGGATGG + Intergenic
1091603174 12:1930052-1930074 GAGGGGGAGAAGGAGGAGGAGGG + Intergenic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091686479 12:2566387-2566409 CAGGGAGAGAAGGGTGGGGTTGG - Intronic
1092046557 12:5435010-5435032 CTGGGGAGGAAGGAGGGGGGAGG - Intronic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092166821 12:6347726-6347748 GAGGGGAAGCAAGATGGGTAAGG - Exonic
1092173943 12:6390359-6390381 GAAGAGAGGAAGGATGGGGAGGG + Intronic
1092232227 12:6782644-6782666 CAAGAGAAGAGGGCTGGGGATGG - Intergenic
1092329598 12:7571528-7571550 CAGGGAAGGAGGGCTGGGGAAGG - Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092881591 12:12891470-12891492 CAGAGGGACAAGGAGGGGGAGGG - Exonic
1092907828 12:13118079-13118101 GAGGGGAAGAAGGAATGGAAAGG - Intronic
1092941943 12:13418057-13418079 CAGAGATGGAAGGATGGGGATGG - Intergenic
1092944737 12:13442195-13442217 CAGGGAAAGAGAGATGAGGAGGG - Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093171230 12:15863116-15863138 GAGGGACAGAAGGATGGGAAAGG - Intronic
1093313816 12:17624071-17624093 CAGTGGTAGCATGATGGGGATGG + Intergenic
1093591498 12:20907392-20907414 GAAGGAAAGAAGGAAGGGGAGGG - Intronic
1094046599 12:26174453-26174475 CGTGGGTAGCAGGATGGGGAAGG - Intronic
1094047959 12:26187651-26187673 CAGAGGTAGAAGGAGGGGAATGG + Intronic
1094162739 12:27408741-27408763 CAGGGCAATAAGGAAGGAGAAGG + Intronic
1094375543 12:29784195-29784217 TCGGGGGAGAAGGATGGGGGCGG - Intronic
1094438646 12:30450488-30450510 AAGGGGAAGAAGTATTGGAAAGG + Intergenic
1095095102 12:38143098-38143120 GAGGGGGAGAAGGGAGGGGAAGG - Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095998365 12:48108362-48108384 AAGAGAAAGAGGGATGGGGAGGG + Intronic
1096183939 12:49566278-49566300 CAGGGGAAGGGGGCTGGGGAGGG - Intronic
1096229535 12:49889412-49889434 CAGGGGAAGGCAGATGGGGTGGG - Intronic
1096257414 12:50071981-50072003 CAGTGGCAGAAGGATGGAGAGGG + Intronic
1096504110 12:52082017-52082039 CCGGGGAAGCAGGATGGGAAGGG - Intergenic
1096886151 12:54721328-54721350 GAGTGGCAGAAGGAGGGGGAGGG - Intergenic
1097250843 12:57631707-57631729 CATGGGGATAAGGATGGGGATGG - Intronic
1097658783 12:62403651-62403673 AAGGGGAAGTAGAATGGAGAGGG + Intronic
1097719143 12:63001636-63001658 CAGGGTAAGAGGTCTGGGGATGG - Intergenic
1097790664 12:63811970-63811992 AAGAGGAGGAAGGAGGGGGAGGG + Intergenic
1098059316 12:66543157-66543179 TGGGGGAAGAAGGCTGGGGACGG + Intronic
1098280051 12:68853722-68853744 AAGAGAAAGAAGGATGGGAAGGG + Exonic
1098653159 12:73000534-73000556 CTGAGGAAGAAGGATGGGAGTGG - Intergenic
1098846224 12:75538961-75538983 GAGGGAAAGAAGGGTGGGTACGG - Intergenic
1098974302 12:76886556-76886578 CAGGGGAGGAGGGCTGGGGTTGG + Intergenic
1099064910 12:77963911-77963933 GAGGAGAAGAAGGAAGGAGAAGG - Intronic
1099169736 12:79349180-79349202 GAGGGAAGGAAGGAAGGGGAAGG + Intronic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1099385309 12:82006249-82006271 GGGGGGAAGGAGGAAGGGGAGGG + Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1099877515 12:88427414-88427436 CAGAGGCAGGAGTATGGGGAAGG + Intergenic
1099959197 12:89380453-89380475 CAGGGGAGGAGGGAATGGGAAGG - Intergenic
1099989831 12:89709597-89709619 CAGGGGAAGGAAGAAAGGGAGGG - Intergenic
1100464784 12:94835230-94835252 CAGGGGAAGAACCAGGGGTAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100550742 12:95644399-95644421 AAGGGGGAGAAGAAGGGGGAAGG - Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101255578 12:102973722-102973744 AAGGGAAAGAGGGAGGGGGAAGG - Intergenic
1101811036 12:108108024-108108046 CAGGGACAGAAGGATGGAAACGG + Intergenic
1101909149 12:108849826-108849848 CAGGGGAGGAGGCATGGGGGAGG + Intronic
1102073942 12:110045024-110045046 AGGGGGAAGAAGGAAGGAGAAGG + Intronic
1102167914 12:110820914-110820936 GAGGGGGAGAGGGAAGGGGATGG - Intergenic
1102167922 12:110820932-110820954 GAGGGGGAGAGGGAAGGGGAGGG - Intergenic
1102171115 12:110843103-110843125 CAGGGGAAGATGGAAGGGGCTGG + Intergenic
1102175199 12:110868749-110868771 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1102397052 12:112595495-112595517 AAGGGGAAGGAGGAGGGAGAGGG - Intronic
1102531093 12:113547205-113547227 GAGGGGAAGATGGATGGGGTGGG + Intergenic
1102551656 12:113696010-113696032 CATGGGATGAGGGATGAGGAGGG - Intergenic
1102595684 12:113990907-113990929 GAGAGGAAGAGGGATGGGGGCGG + Intergenic
1102599407 12:114017822-114017844 GAGGGGAAGCAGGATAGGAAAGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102902240 12:116647416-116647438 GAAGGGAAGAAGGAAGGGAAGGG - Intergenic
1103235377 12:119368177-119368199 GAGGAGAAAAAGGAGGGGGAAGG + Intronic
1103477930 12:121232370-121232392 CAGGGGGAGATGGCTGGGGCAGG - Intronic
1103523061 12:121549109-121549131 CATGGGAGGAAGGAAGGGCAGGG + Intronic
1103678956 12:122678307-122678329 CAAGGGAGGAAGGAAGGGAAAGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103906060 12:124327805-124327827 CAGGAAAAAAAGGGTGGGGAGGG - Intronic
1103972120 12:124678892-124678914 CAGGGGAGGGAGGAAGAGGAGGG - Intergenic
1104095087 12:125549934-125549956 CAGGGAGAGAAGGATGGTGTAGG - Intronic
1104492920 12:129209861-129209883 CAGGGCAACTATGATGGGGAAGG + Intronic
1104736392 12:131138258-131138280 CTGGGGAAGGAGGATGGGCTGGG - Intronic
1104854038 12:131894128-131894150 GAGGGGAACAGGGAAGGGGAGGG + Intergenic
1104916431 12:132267212-132267234 CAGGGGAACCAGGGCGGGGAAGG + Intronic
1104919530 12:132283340-132283362 GACGGGAGGAATGATGGGGACGG + Intronic
1105341426 13:19529625-19529647 CAGGAGAAGAAAGTAGGGGAAGG - Intronic
1105575809 13:21650568-21650590 AAGAGGAAGAAGGAGGGGGCTGG - Intergenic
1105738332 13:23295708-23295730 GAGAGGAAGAAGGAGGAGGAAGG - Intronic
1106331539 13:28743879-28743901 GAGGGGAAGAGGGATAGGAAGGG + Intergenic
1106554194 13:30796131-30796153 CAGGGGGAGAATGCTGAGGATGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106615464 13:31323103-31323125 CAGGGGACGGAGGAGGGGGTTGG + Intronic
1106679956 13:31999445-31999467 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1107002302 13:35562541-35562563 CAGGAGAAAAAGGTTGGGGTTGG - Intronic
1107097531 13:36552645-36552667 CCTGAGAAGAAGGATGGGAAAGG + Intergenic
1107320097 13:39177434-39177456 TAGGGGAAGAAGGCCGGTGAGGG + Intergenic
1107455602 13:40551928-40551950 TAAGGGCAGAAGGAAGGGGAGGG - Intergenic
1107469055 13:40675023-40675045 CTGGGGAAGTAGGGTGGAGAAGG + Intergenic
1107682556 13:42866709-42866731 GAAAGGAAGAAGGATGGGGCAGG - Intergenic
1107855107 13:44607404-44607426 AAGTGGAAAAGGGATGGGGATGG - Intergenic
1108167420 13:47708157-47708179 CAGGGTAAGGAGGATCTGGAAGG - Intergenic
1108478320 13:50843037-50843059 CAGTGGGAGAAGGAAGGGGGCGG - Intronic
1108492369 13:50994222-50994244 GAGGGGAAGGCGGAGGGGGAGGG - Intergenic
1109039243 13:57310805-57310827 CACAGGATGAAGGATGGGGCAGG - Intergenic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1110079461 13:71292319-71292341 TAAGGGAAGAATCATGGGGAAGG - Intergenic
1110218947 13:73052554-73052576 AAGTGGAAGGAGGGTGGGGATGG - Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1110775721 13:79406030-79406052 CTGGGGAAGAGGGAAGGGGGAGG - Exonic
1110860695 13:80341810-80341832 CGGGGGGAGAAGAAGGGGGAGGG + Intergenic
1110924799 13:81137991-81138013 CAGAGGAAGTGGGAGGGGGAAGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111405529 13:87799614-87799636 CAGGGAAAGAAGGAAGAGCATGG + Intergenic
1112072916 13:95874676-95874698 GAGGAGGAGAAGGAAGGGGATGG - Intronic
1112460845 13:99602550-99602572 ATGGGAAAGAAGGATGGGGCGGG - Intergenic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112781620 13:102906932-102906954 TAGAGGAAGATGGATGGGGAAGG - Intergenic
1113130272 13:107028919-107028941 CAGCAGGAAAAGGATGGGGAGGG - Intergenic
1113317000 13:109191449-109191471 CAGGGTAAGCAGGGTTGGGAGGG + Intronic
1113319613 13:109221040-109221062 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1113388776 13:109875607-109875629 TAGGGGAGGAAAGATAGGGAAGG + Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113808576 13:113123827-113123849 CAGGGGACAGAGGCTGGGGAGGG - Intronic
1113851171 13:113419039-113419061 AAGGAGAAGAAGGAAGGGAAGGG - Intergenic
1113909751 13:113836404-113836426 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1113909758 13:113836422-113836444 GAGGGGGAGGAGAATGGGGAAGG + Intronic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114605827 14:23995375-23995397 CCAGGGAAGAAGCCTGGGGAGGG - Intronic
1114611330 14:24042932-24042954 GCCGGGAAGAAGGCTGGGGAGGG - Intergenic
1114742532 14:25112771-25112793 AAAGGGAAAAAGGATGTGGAAGG - Intergenic
1115059278 14:29170261-29170283 CATGGAAAGAAGGATGGAAATGG + Intergenic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1115390054 14:32844044-32844066 CAGAGGAAGAATGAATGGGAGGG - Intergenic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115498166 14:34027185-34027207 GAGGGGGAGGAGGAAGGGGAAGG + Intronic
1115566538 14:34629843-34629865 CCGGGGACCCAGGATGGGGAAGG + Intronic
1115704634 14:35986497-35986519 TAGGGGGAGCAGGATGTGGATGG + Intergenic
1115784011 14:36804214-36804236 CTAGGGAAGAAGGAAAGGGATGG - Intronic
1115804128 14:37032080-37032102 TATGGGAAAAATGATGGGGAAGG - Intronic
1115822811 14:37229900-37229922 CAGGGGCTAAAGGTTGGGGATGG + Intronic
1116217905 14:42044081-42044103 AAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1116217912 14:42044100-42044122 AAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1117340613 14:54788467-54788489 CAGGAGGAGGAGGGTGGGGATGG - Intronic
1117355321 14:54918551-54918573 CAGGGGAAGAGGGATTTAGAGGG + Intergenic
1117667851 14:58076094-58076116 GAGGGGAAGGGGGAGGGGGAAGG + Intronic
1117722801 14:58643818-58643840 TGGGAGAGGAAGGATGGGGAAGG + Intronic
1118157767 14:63257775-63257797 CACGGGAGAAAGGCTGGGGAGGG - Intronic
1118299896 14:64605926-64605948 CAGGAGAGGGAAGATGGGGATGG + Intergenic
1118775662 14:68972364-68972386 CAGGGGAAGAGGGACAAGGATGG + Intronic
1118963648 14:70559392-70559414 CAGGGTGATAATGATGGGGATGG - Intergenic
1119054697 14:71407483-71407505 GAGGGAAGGAAGGAAGGGGAGGG - Intronic
1119145900 14:72313752-72313774 CTGGGGAGTAAGGATGGAGAAGG + Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119319992 14:73724925-73724947 CAGAGGAAGATGCAGGGGGAGGG - Intronic
1119326833 14:73764836-73764858 CAGGGCAGGGAGGCTGGGGAGGG - Intronic
1119714015 14:76845367-76845389 AAGGGGAAGAGGGAGGGGGAGGG + Intronic
1119862830 14:77948878-77948900 TAGGGGAAGGGGGAGGGGGAAGG - Intergenic
1119870442 14:78012340-78012362 GAAGGAAAGAAGGAAGGGGAAGG - Intergenic
1119932008 14:78556901-78556923 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120726181 14:87944075-87944097 GTGGGGACGAGGGATGGGGAAGG - Intronic
1120754888 14:88233502-88233524 CTGGGGACAAAGCATGGGGAAGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121316483 14:92964104-92964126 CGGGGGAATGAGGATGAGGAGGG - Intronic
1121428852 14:93873012-93873034 CAGGGCAAGAAGGATGGGACAGG + Intergenic
1121443402 14:93963144-93963166 CAGGGGATGAAGGTGGGTGATGG - Intronic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1121782135 14:96628732-96628754 CAGGGGAAGAAAGGTGGAAAGGG + Intergenic
1121902565 14:97707226-97707248 TCAGGGAAGAAGGATGGAGAAGG + Intergenic
1121991683 14:98563983-98564005 CAGCACCAGAAGGATGGGGAAGG + Intergenic
1122058837 14:99123282-99123304 CAGGGGAAGAGGGAAGGGGAAGG - Intergenic
1122082427 14:99274745-99274767 GAGGGGGAGAAGGAGGAGGAGGG - Intergenic
1122124935 14:99573798-99573820 CAGGGGCAGAGGGATTGGGTGGG - Intronic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122647933 14:103207386-103207408 GAGGGGAAGGAGGAAGGGGAAGG - Intergenic
1122687178 14:103514900-103514922 GAGGGGAAGAGGGATGCAGAAGG + Intergenic
1122711075 14:103658563-103658585 CAGAGAAAGAAGGCTGGGCATGG - Intronic
1122751535 14:103937463-103937485 CTGGGAAAGAAGGGAGGGGAGGG - Intronic
1122966036 14:105126494-105126516 GAGAGGAAGAAGGATGAGGAAGG + Intergenic
1123151495 14:106185965-106185987 CAGGTGAAGGAGGCTGGGGAGGG - Intergenic
1123477479 15:20599996-20600018 CAGGGGGAGAGAGACGGGGATGG - Intergenic
1123640537 15:22400386-22400408 CAGGGGGAGAGAGACGGGGATGG + Intergenic
1123991595 15:25687572-25687594 CAGGCGAAGGAGGATGGAGCAGG + Intronic
1124010912 15:25837861-25837883 GTGGGGAAGACGGGTGGGGAGGG + Intronic
1124216182 15:27808661-27808683 CAGGCTATGAAGGATGGGTAGGG + Intronic
1124818043 15:33016754-33016776 CCGGGGAAGAAGGAGGGGTGAGG - Intronic
1124860767 15:33438308-33438330 CTGGGGGTGGAGGATGGGGAGGG - Intronic
1125725604 15:41866737-41866759 CAGGGCAAGAGAGGTGGGGAAGG - Intronic
1126120170 15:45244512-45244534 GAGGAGGAGAAGGAAGGGGAGGG + Intergenic
1126388772 15:48122482-48122504 CTGGGAAAGGAAGATGGGGAGGG - Intronic
1126572122 15:50163853-50163875 AAGGGGAAGGAAGAAGGGGAAGG - Intronic
1126837341 15:52679797-52679819 GAGGGGGGGAAGGAGGGGGAGGG - Intronic
1126916799 15:53475020-53475042 CAGGGTAAAAGGGATGGGGGTGG - Intergenic
1127435137 15:58949912-58949934 CAAGGGGAGAGGAATGGGGAGGG + Intronic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128363451 15:66979555-66979577 AAGGGGAGGGAGGAAGGGGAAGG - Intergenic
1128694877 15:69753996-69754018 CTGGGGAAGACAGATGGGGCTGG - Intergenic
1128740978 15:70083532-70083554 GAGGGGAGGGAGGAGGGGGAAGG - Intronic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129247224 15:74286894-74286916 GAGGGGAAGAGGGAGGGGGAAGG - Intronic
1129295028 15:74595558-74595580 CAGAGGAAGAGCGAAGGGGAGGG - Intronic
1129338950 15:74872655-74872677 CAGGGAAAGAAAGATGGGAGAGG - Intronic
1129491139 15:75926723-75926745 GAGAGAAGGAAGGATGGGGAAGG + Intronic
1129695677 15:77739496-77739518 CAAGGGAAAAAGGAGGGGAAAGG - Intronic
1129843630 15:78758393-78758415 CAGGGGCGGGAGGCTGGGGAAGG - Intergenic
1130216342 15:81973861-81973883 AAGAGGAAGAAAGACGGGGAAGG + Intergenic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1130915696 15:88302817-88302839 CAGGGGATGCAGTTTGGGGATGG + Intergenic
1130930539 15:88423799-88423821 CAGGAAAAGAAGTATGGGGGTGG + Intergenic
1130989979 15:88870358-88870380 CAGGGGAAGAAGGAAGAAGGGGG + Intronic
1131119632 15:89814452-89814474 CTGGGGAGGACGGACGGGGAGGG - Intronic
1131132922 15:89911786-89911808 CAGGGGATAGTGGATGGGGATGG - Intronic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131317611 15:91353814-91353836 CAGGTGAAGGAGGAAGGGCAAGG - Intergenic
1131458510 15:92602098-92602120 CAGGGGAAGAATGCTGGTGGAGG - Intergenic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131501551 15:92972471-92972493 CAGTGTAGGAAGGTTGGGGAGGG - Intronic
1131641573 15:94299029-94299051 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1131646256 15:94348421-94348443 GAGGGGGAGGAAGATGGGGAGGG - Intronic
1131805179 15:96114774-96114796 CAGGGGGAGAAAAGTGGGGAAGG - Intergenic
1131836025 15:96392084-96392106 CAGGCAATGAAGGATGGTGATGG + Intergenic
1131947691 15:97644654-97644676 CAGGGGTGGAAGGCTGGGGGAGG + Intergenic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133042415 16:3067684-3067706 CAGGGTGAGAAGGATGAAGAGGG + Intronic
1133050320 16:3113783-3113805 CAGGTGGAGAAGCACGGGGAAGG - Intronic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133485559 16:6215228-6215250 GAGGGGAAGAAGGAGAGGGAAGG + Intronic
1133510720 16:6454784-6454806 AATGGGAAGAAGCAAGGGGAGGG - Intronic
1133989299 16:10692270-10692292 CCTGGGAAGAATGATGGGCAGGG - Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134302060 16:13000684-13000706 CGGGGGATGACGCATGGGGATGG + Intronic
1134549335 16:15131988-15132010 CAGGGGGATAAGGGAGGGGAAGG + Intronic
1134549401 16:15132178-15132200 GAGGGGGATAAGGATGGGAAGGG + Intronic
1134692161 16:16197960-16197982 GAGGGGGAGAAGGAGGGGGTGGG + Intronic
1134765689 16:16755709-16755731 AAGGGGAAGAAGGAGAGGAAGGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134980361 16:18603504-18603526 AAGGGGAAGAAGGAGAGGAAGGG + Intergenic
1135001596 16:18781202-18781224 CAGGGGAAGAAGGAGTGGTGTGG - Intergenic
1135135605 16:19884124-19884146 CTGGGGACGAATGACGGGGAGGG - Intronic
1135166826 16:20146492-20146514 AAGGGGAGGAAGGAGGGAGAAGG + Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135499127 16:22978431-22978453 AAGGGGCAGAAGGAAGGTGAGGG + Intergenic
1135543643 16:23351479-23351501 CAGGAACAGGAGGATGGGGAAGG - Intronic
1135628168 16:24014263-24014285 CAGGGGGAGAGGGGTGGGGAGGG + Intronic
1135731743 16:24900384-24900406 CAGGAGAAAAGAGATGGGGAAGG + Intronic
1135942452 16:26834310-26834332 GAGAAGAAGAAGGAGGGGGAGGG + Intergenic
1135952832 16:26931239-26931261 TAAAGGAAGAAGGATGGAGAGGG - Intergenic
1136045913 16:27614819-27614841 CAGGGGAAGATGGAAGCAGATGG + Intronic
1136081345 16:27854325-27854347 AAGGGGGAGGAGGAGGGGGACGG + Intronic
1136393585 16:29980468-29980490 GGTGGGAGGAAGGATGGGGATGG - Intronic
1136403532 16:30030840-30030862 CAGGAGGAGGAGGATGCGGATGG + Exonic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1136711505 16:32240648-32240670 TAGGGGGCCAAGGATGGGGATGG + Intergenic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1136849718 16:33603189-33603211 GAGGAGAGGAAGGATGGGAAGGG - Intergenic
1137270424 16:46899425-46899447 CTGGGGCAGAGGGCTGGGGAGGG + Intronic
1137476234 16:48811761-48811783 CGGGGCAAGAAGGATGGGGCTGG - Intergenic
1137537654 16:49339707-49339729 CATGGTAAGAAGGATTGGGTGGG + Intergenic
1137567858 16:49544691-49544713 CAGGGGCTGAAGGCTTGGGAGGG + Intronic
1137676022 16:50304274-50304296 CAGGGAGAGCTGGATGGGGATGG + Intronic
1137766663 16:50982642-50982664 CAGGGCGAGAAGAAAGGGGAAGG + Intergenic
1137833013 16:51562323-51562345 TATGGGAAGAAGGAGGGGGATGG + Intergenic
1137965270 16:52926454-52926476 CTTGGGCAGAAGGATGGGAAGGG + Intergenic
1137970733 16:52982169-52982191 CAGGGGAAGAGGGGATGGGAAGG + Intergenic
1138033358 16:53578845-53578867 CTGGAGAAGAAGCATGGGAAGGG - Intergenic
1138316343 16:56073347-56073369 GAGGGGAAAAAGGATGGGGGAGG - Intergenic
1138354985 16:56370425-56370447 CAGGGGCTGAAGGTTGGGGAAGG + Intronic
1138530017 16:57629842-57629864 CAGGGGAGGTGGGTTGGGGACGG - Intronic
1138579407 16:57930552-57930574 GAGGGGAAGGAGGAGGGGAAGGG + Intronic
1138796438 16:59975248-59975270 CAAGGGAAGTCGGATGGGGTGGG + Intergenic
1138849120 16:60605297-60605319 TAGGGGAAGCCAGATGGGGATGG + Intergenic
1138964873 16:62072091-62072113 CAGTGGAAGAAGCTGGGGGAAGG - Intergenic
1139004276 16:62551563-62551585 AAGGGGAAAAAGGAAAGGGAAGG - Intergenic
1139298209 16:65921383-65921405 CAGGTGAAGGGTGATGGGGAAGG - Intergenic
1139320395 16:66109658-66109680 GAAGGGAAGAAGGAAGGGGAGGG + Intergenic
1139428146 16:66895790-66895812 CAGGGGAGGACAGATGGGAATGG - Intergenic
1139480676 16:67228921-67228943 CAGGGAATAAAAGATGGGGAGGG - Intronic
1139824221 16:69744589-69744611 CAGGAGTTGAAGGATGGGCAGGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139908801 16:70383891-70383913 TAGGGGAGGAAGGTTGGGGCTGG - Intronic
1139946273 16:70644708-70644730 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1140018683 16:71215257-71215279 AAAGGGAGGAAGGAGGGGGAAGG + Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140476607 16:75242281-75242303 CCGGGGAAGATGGATGTGAATGG - Intronic
1140695005 16:77524089-77524111 GAGGGGAAGATGAATGGGGCTGG + Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141046677 16:80721807-80721829 CACCAGGAGAAGGATGGGGATGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141631684 16:85291460-85291482 CCGGGGGAGGAGGCTGGGGAGGG - Intergenic
1141638883 16:85329808-85329830 CCTGGGAAGAAGGCTGGGGACGG + Intergenic
1141673073 16:85502988-85503010 GAGGGTAAGAAGGCTGGGAAAGG + Intergenic
1141714019 16:85716650-85716672 CAGAGGGAGAAGGAGGAGGAAGG + Intronic
1141810258 16:86371295-86371317 GAGGGGCAGAAGGAAGGGCAAGG - Intergenic
1141824830 16:86471721-86471743 CAAGGGGAGAAGGGAGGGGAGGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1141896055 16:86959371-86959393 AAGGGGAAGATGGATGGGGCTGG + Intergenic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203058549 16_KI270728v1_random:949111-949133 TAGGGGGCCAAGGATGGGGATGG - Intergenic
1142766553 17:2067666-2067688 GAGGGGAAGGAAGACGGGGAGGG + Intronic
1143159101 17:4857388-4857410 GAGGGGGACAAGGATGGGCATGG + Intronic
1143373782 17:6455693-6455715 AGGGGGAAGAAGGGAGGGGAGGG + Intronic
1143512935 17:7405840-7405862 GAAGGGGAGAAGGAGGGGGAGGG - Intronic
1143838458 17:9711859-9711881 CTGGGGCTGAAGGATGGGGCCGG + Intronic
1143968003 17:10770671-10770693 GTGAGGAAGATGGATGGGGAGGG + Intergenic
1143994808 17:10997229-10997251 CTGGGGCAGAGGGCTGGGGAAGG - Intergenic
1144070196 17:11664591-11664613 CTGAGGAAGGAGGATGGGGTTGG - Intronic
1144126806 17:12210497-12210519 GAGAGGAAGAAGGAAGAGGAAGG - Intergenic
1144709125 17:17388754-17388776 CAGAGGAGGAAGGAGAGGGATGG - Intergenic
1144773779 17:17773781-17773803 CAGGGGAAGAAGGGCTAGGAGGG - Intronic
1145268220 17:21390550-21390572 CGGGGGCACAGGGATGGGGAGGG + Intronic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145994453 17:29097409-29097431 GAGGGGAAGGAGGATGGGGCAGG + Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146505224 17:33399126-33399148 CAGGGAAAGAAATATGGGGTTGG + Intronic
1146573092 17:33969519-33969541 CTGGGGAACAAGAAAGGGGAAGG + Intronic
1146601589 17:34221758-34221780 CAGGGTGAGAAGGCTGGGAATGG + Intergenic
1146616392 17:34360300-34360322 CAGGGGCTGAAGGATGGGTCAGG - Intergenic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1146741457 17:35287832-35287854 CTGGGGGAGAAGGCTGGGCATGG + Intergenic
1146824884 17:36013551-36013573 CAGGGGGAAAAGGGTGGGGAAGG - Intronic
1146924309 17:36733455-36733477 CAGGGGACTAGGGCTGGGGAAGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147242465 17:39099460-39099482 CATGGGATGCAGGATAGGGAAGG + Intronic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147341761 17:39756530-39756552 GAGGGGAAGAAGGAGGGTGCAGG + Intergenic
1147361565 17:39933947-39933969 GGTGGGAAGAAGGAGGGGGAGGG + Intergenic
1147416616 17:40295898-40295920 GAGGGGCAGGAGGATGGGAAGGG - Intronic
1147495284 17:40909543-40909565 CAGAGAAAGAAGGATGGTAATGG - Intergenic
1147579326 17:41619470-41619492 CAGGCAAGGAAGCATGGGGAAGG + Exonic
1147626586 17:41904306-41904328 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1147626593 17:41904328-41904350 GAAGGGAAGAAGGAAGGGAAGGG + Intronic
1147626598 17:41904345-41904367 GAAGGGAAGAAGGAAGGGAAGGG + Intronic
1147847069 17:43412013-43412035 TAGGGACAGAAAGATGGGGAGGG - Intergenic
1147899542 17:43774988-43775010 CAGGGGGAGGAAGATGGAGAAGG + Intronic
1147914495 17:43878457-43878479 CAGTGGAAGCTGGATGGGCAGGG + Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1147977200 17:44254692-44254714 CAAGGGCAGGAGGATGGGGAAGG + Intronic
1148180723 17:45602647-45602669 GAGAGAAAGAAGGAAGGGGAGGG - Intergenic
1148190440 17:45675006-45675028 CTGGGGAGGAAGGCAGGGGAAGG - Intergenic
1148211992 17:45814096-45814118 GAAGGGAAGAAGGAAGGGCAGGG + Intronic
1148268180 17:46243279-46243301 GAGAGAAAGAAGGAAGGGGAGGG + Intergenic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148463660 17:47851774-47851796 GAGGGAAAAAAGGACGGGGAAGG - Intronic
1148466616 17:47868820-47868842 TGGGGGAAGAAGGAGGGGGCTGG + Intergenic
1148480898 17:47958804-47958826 AAGGGCAAGAAGGCAGGGGATGG + Intergenic
1148486930 17:47996586-47996608 GAGGGGAAGGAGGATAGGGGTGG - Intergenic
1148617939 17:49014250-49014272 GAGGGGGAGACAGATGGGGACGG - Intronic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1148682855 17:49484635-49484657 AAGGGGAGGAGGGGTGGGGAGGG - Intergenic
1148781316 17:50123666-50123688 GAGGGGGAGGAGGATAGGGAAGG - Intronic
1148856358 17:50581132-50581154 CAGGGGAGAAAGGATATGGAGGG + Intronic
1149134027 17:53343303-53343325 TAGGGAAAGAGGGATTGGGAGGG + Intergenic
1149261318 17:54882824-54882846 AAAGGAAAGAAGGAAGGGGAGGG + Intergenic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149475883 17:56960659-56960681 GAGGGGATGGGGGATGGGGAAGG - Intronic
1149500577 17:57149313-57149335 GAGGGGAAAAATGAGGGGGAAGG + Intergenic
1149554298 17:57562160-57562182 GATGGGCAGATGGATGGGGATGG - Intronic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1149612467 17:57967635-57967657 CTGAGGGAGAAGAATGGGGAGGG - Intergenic
1149632841 17:58141783-58141805 GAGAGGAAGAGGGAGGGGGAGGG - Intergenic
1149648019 17:58254654-58254676 CAGGTGAATAGGGATGGGGAGGG - Intronic
1149684836 17:58529360-58529382 GAGGAGAAGAGGGGTGGGGAAGG - Intronic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1150152242 17:62819584-62819606 AAGGAGAGGAAGGATGGAGAGGG - Intergenic
1150272682 17:63876737-63876759 CATTGGAAGAAGGATGGTGAGGG - Intronic
1150296116 17:64008341-64008363 CTGGGACAGAAGGGTGGGGATGG + Intronic
1150455479 17:65303722-65303744 GAGGGAAAGAAAGATGGAGAGGG + Intergenic
1150942259 17:69705840-69705862 CACGGGACTAAGGATGGTGAAGG - Intergenic
1150964019 17:69947219-69947241 CAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1151291859 17:73156258-73156280 GATGGGCAGGAGGATGGGGAGGG + Intergenic
1151459500 17:74246096-74246118 CCCTGGAAGAAGGAAGGGGAAGG + Intronic
1151584889 17:75003010-75003032 CAGGGGGAGAAGGGTGGAGGAGG + Intronic
1151845435 17:76651191-76651213 CAGGGGCAGAGGGTTGGGGAAGG - Intergenic
1151859055 17:76745689-76745711 CAGGAGAAGAGGGAGGGAGATGG - Intronic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152037731 17:77883668-77883690 CAAGGGAGGAAGGCTAGGGAGGG - Intergenic
1152336629 17:79702847-79702869 GAGGGGGAGGAGGAAGGGGAGGG - Intergenic
1152369593 17:79878095-79878117 CGGGGGGAGGAGGATGGGGAAGG + Intergenic
1152410550 17:80120538-80120560 GAGGTGAAGTGGGATGGGGACGG - Intergenic
1152448234 17:80359084-80359106 CAGGGAATGAGGGACGGGGAGGG - Intronic
1152456278 17:80418298-80418320 CAGGAGAAGTTGGAGGGGGAAGG - Intronic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1152609217 17:81307443-81307465 AAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1152628106 17:81397541-81397563 AAGGGAAAGAAGGAAAGGGAGGG - Intronic
1152668995 17:81590248-81590270 CTGGGAGAGAAGGATGGGGTGGG - Intronic
1152870470 17:82751054-82751076 ACGGGGATGGAGGATGGGGACGG - Exonic
1153226419 18:2903416-2903438 CGTGGGAAGAAGGATGGGGAAGG - Intronic
1153987662 18:10367867-10367889 GAGGGGAAAAAGGAAAGGGAAGG + Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1154290122 18:13099166-13099188 CATGGGGAGAGGGAGGGGGAGGG + Intronic
1155016560 18:21846808-21846830 CAGGGGTAGAGTGGTGGGGAGGG + Intronic
1155178743 18:23324731-23324753 CAGGGGAGGAAGAGTGGGAAGGG + Intronic
1155488205 18:26370453-26370475 CAGGGGTAGAAGGACTGGCAAGG - Intronic
1155605645 18:27602480-27602502 CAGGGGGAGATGGATCTGGAGGG + Intergenic
1155778194 18:29794566-29794588 CATGGGCAGAAGCCTGGGGATGG + Intergenic
1156055653 18:32999259-32999281 AAGGGGAGGAAAGAGGGGGAAGG + Intronic
1156462102 18:37326828-37326850 AAGTGGCAGAGGGATGGGGAGGG - Intronic
1156463242 18:37333362-37333384 GAGGGGAAGAAGGGAGAGGAGGG - Intronic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1157214690 18:45773157-45773179 GAGGGGGAGAGGGAGGGGGAGGG - Intergenic
1157330406 18:46699969-46699991 CAGTGGCAGAAAAATGGGGAAGG + Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157686893 18:49650143-49650165 TAGGGGAAGAGGGAAGGGGAAGG + Intergenic
1158939768 18:62396541-62396563 AAGGGAAATAAGCATGGGGAAGG - Intergenic
1159517671 18:69478395-69478417 AAGGAGGAGAAGGAAGGGGAGGG - Intronic
1159970749 18:74648962-74648984 CAGGGGATCAAGGGTGCGGAGGG - Intronic
1160050806 18:75431531-75431553 CAGGGGTGGGAGGAAGGGGATGG - Intergenic
1160237675 18:77098955-77098977 GAGGAGAAGAGGGAGGGGGAAGG - Intronic
1160391475 18:78536726-78536748 CAGGGAAAGAAGGAAAGGAAGGG + Intergenic
1160409785 18:78667812-78667834 CGGGGTAGGATGGATGGGGAGGG - Intergenic
1160488498 18:79316425-79316447 CATGGGAAGAAGGCTGCTGAGGG - Intronic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160659503 19:291532-291554 GAGGGGAGGAGGGAGGGGGAGGG + Intergenic
1160676474 19:393954-393976 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676500 19:394065-394087 GACGGGAAGGATGATGGGGAAGG + Intergenic
1160676504 19:394078-394100 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676508 19:394091-394113 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676527 19:394164-394186 GACGGGAAGGATGATGGGGAAGG + Intergenic
1160676531 19:394177-394199 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676551 19:394251-394273 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160676561 19:394288-394310 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160676613 19:394549-394571 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160676699 19:394933-394955 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160676726 19:395056-395078 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160676774 19:395256-395278 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676799 19:395356-395378 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676824 19:395456-395478 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160676834 19:395493-395515 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160676857 19:395591-395613 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160676864 19:395616-395638 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160690892 19:460410-460432 GAGAGCAGGAAGGATGGGGAGGG + Intronic
1160695188 19:480461-480483 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160695200 19:480512-480534 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695204 19:480525-480547 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695222 19:480613-480635 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160695373 19:481434-481456 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160695380 19:481459-481481 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160695390 19:481496-481518 GATGGGAAGGATGATGGGGAAGG + Intergenic
1160695394 19:481509-481531 ATGGGGAAGGATGATGGGGAAGG + Intergenic
1160749388 19:726908-726930 CAGAGGAAGCAGGATCGGGCTGG + Intronic
1160819810 19:1052602-1052624 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1160900240 19:1424332-1424354 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
1161030716 19:2056662-2056684 GAGAGGAGGAAGGATGAGGAGGG - Intergenic
1161139649 19:2639842-2639864 GAGGGAAGGAAGGAAGGGGAGGG + Intronic
1161164438 19:2778555-2778577 CAGGGTAACAGGGATGGGGTAGG - Intronic
1161343059 19:3753169-3753191 TACGGGGAGAAGGAAGGGGAGGG + Intronic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161448299 19:4329918-4329940 GAGGGGCTGCAGGATGGGGACGG - Intronic
1161514454 19:4688986-4689008 CAGGGGCAGAGGGATGGGGGCGG - Intronic
1161847708 19:6721087-6721109 GAGGGGAAGTAGAATGGGGGAGG + Intronic
1161879741 19:6940157-6940179 CTGGGGAAGAATGTTGGGGGCGG + Exonic
1161918304 19:7247227-7247249 AAGTGGATTAAGGATGGGGAAGG - Intronic
1161957856 19:7506349-7506371 CAGGGGATGAAGCCGGGGGAGGG - Intronic
1162038107 19:7953384-7953406 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
1162038143 19:7953479-7953501 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
1162055532 19:8061498-8061520 AAGGGGAAGAAGGTTGGCAATGG - Intronic
1162062169 19:8102693-8102715 GCTGGGAAGAAGGTTGGGGAGGG + Intronic
1162094519 19:8302624-8302646 CAGAGGAGTAAGGAGGGGGAAGG + Intronic
1162184406 19:8893817-8893839 CATGGGAAGAATGATGGTGGTGG - Intronic
1162232795 19:9281627-9281649 AGGGTAAAGAAGGATGGGGAAGG + Intergenic
1162873697 19:13604784-13604806 GAAGGGAAGGAGGAAGGGGAAGG + Intronic
1162938474 19:13993896-13993918 CTTGGGAAGAAAGACGGGGATGG + Intronic
1163004565 19:14389265-14389287 GAGGGGAAGGGGGAAGGGGAGGG + Intronic
1163004581 19:14389294-14389316 GAGGGGAAGGGGGAAGGGGAGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163511738 19:17739538-17739560 CAGTGGAAGAGGGGTGGGGGTGG + Intergenic
1163518668 19:17779522-17779544 CGGAGGAGTAAGGATGGGGAAGG + Intronic
1163701666 19:18789513-18789535 GAGGGGAGGAAGGATGAGGGCGG + Intronic
1163779630 19:19239632-19239654 GAGTGGAAGGAGGAGGGGGAGGG - Intronic
1164326237 19:24194802-24194824 CAGGTGAAAAAGAATGGGCATGG - Intergenic
1164431648 19:28194113-28194135 GAGGGGAAGAAGATTGGAGAGGG + Intergenic
1164441582 19:28283833-28283855 GATAGGAAGAAGGTTGGGGATGG - Intergenic
1164441897 19:28285128-28285150 GAGGGGAAGAAGGAGAAGGAGGG + Intergenic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164714834 19:30383958-30383980 GAGTGGAAGAAGGAAGGGAAGGG - Intronic
1164729129 19:30488754-30488776 CAAGGGGAGAAGAAAGGGGAGGG - Intronic
1164760971 19:30727978-30728000 CAGGAGGAAAAGGATGGGGAAGG + Intergenic
1165051786 19:33146491-33146513 GAAGGGAGGAAGGAAGGGGAAGG - Intronic
1165363936 19:35352465-35352487 CGGGGGAAGGAGCATGGGGCAGG + Exonic
1165462691 19:35953354-35953376 CTGGGGAAGAGGGATGGCGTGGG - Intergenic
1165506940 19:36239036-36239058 TGGGGGTAGAAGAATGGGGATGG - Intronic
1165730618 19:38142539-38142561 CAGGGGAGGAAGGAGGCAGAGGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165887080 19:39085763-39085785 GAGGAGAAGAGGGATGGAGAAGG - Intronic
1165926010 19:39326716-39326738 GAGGGGGAGAGGGAAGGGGAGGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166257180 19:41614962-41614984 GAGGGGAAAAGGGAAGGGGAAGG + Intronic
1166398135 19:42457437-42457459 CAGGAGTGGAAGGATTGGGAAGG + Intergenic
1166550728 19:43664397-43664419 CAGGAGAGGAAGGGTGGGGAAGG - Intronic
1166557024 19:43707039-43707061 CAGGGGAAAAAGGATGTCTAGGG - Intergenic
1166654423 19:44599762-44599784 AAGGGAAAGAAGAATGGGCATGG + Intergenic
1166803983 19:45474003-45474025 GAGGGGAGGAAGAAGGGGGATGG - Exonic
1166944697 19:46389854-46389876 GAGGGGCAGGAGGATGGGGATGG - Intronic
1166960649 19:46494168-46494190 CAGGCGAAGAAGGCTGGGCGTGG - Exonic
1167047772 19:47060890-47060912 AAAAGGAAGAAGGGTGGGGAAGG + Intergenic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167240840 19:48342206-48342228 AAGGGGAAGAAGGAAGGGAAGGG + Intronic
1167334372 19:48875549-48875571 CACGGGAATCCGGATGGGGAGGG - Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167663075 19:50807836-50807858 CTGGGGTAGAGGGATAGGGAAGG - Intergenic
1167686528 19:50960082-50960104 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167686535 19:50960100-50960122 GAGGGGGAGGAGGATGGAGAGGG + Intronic
1167686544 19:50960118-50960140 GAGGGGGAGGAGGATGGGGAGGG + Intronic
1167739013 19:51312673-51312695 CAGTGGAAGAGCGATGGGCATGG + Intronic
1168133115 19:54333488-54333510 AAGGGGAAGAAGCATGGGTCAGG - Exonic
1168148527 19:54432660-54432682 CATGGGGGGATGGATGGGGAGGG - Intronic
1168261889 19:55199959-55199981 AAGGGAAGGAAGGAAGGGGAAGG + Intronic
1168433805 19:56302320-56302342 AAAGGGAAGGAGGAAGGGGAGGG - Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168691765 19:58381702-58381724 GAGGGGGAGAAGGAGGGGGAGGG - Intergenic
1168725388 19:58578419-58578441 GAAGGAAAGAAGGATGGGAAAGG - Intergenic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925342882 2:3149009-3149031 CAGCCGGAGATGGATGGGGAGGG + Intergenic
925377539 2:3398961-3398983 CAGGGGAGGTGGGAGGGGGAGGG - Intronic
925476435 2:4221916-4221938 CTGGAGAAGAGAGATGGGGAAGG + Intergenic
925772653 2:7298386-7298408 CTGGGGAAGACGTATGTGGATGG - Intergenic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
925920331 2:8633639-8633661 AGGGGGACGAAGGAGGGGGAAGG - Intergenic
925927586 2:8681666-8681688 GAGGGGAAGGAGGAGGGAGAAGG - Intronic
926152526 2:10432884-10432906 CTGGGGCAGGAGGCTGGGGAGGG + Intergenic
926235505 2:11040223-11040245 CAAGGAAAGAAGGATGGGGCAGG - Intergenic
926292303 2:11540863-11540885 CAGCTGAGGAAGGATGGGAATGG - Intronic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926731381 2:16038286-16038308 CAGGGGAGGAGGGAGGGAGATGG + Intergenic
926752840 2:16212041-16212063 CAGGGGAGAAAGGCTGGAGAAGG + Intergenic
926826854 2:16914297-16914319 TTGGGGAAGAAGTATGTGGATGG + Intergenic
926848983 2:17173975-17173997 GAGGGAAAGAAAGAGGGGGAAGG - Intergenic
927008798 2:18880353-18880375 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927441803 2:23124096-23124118 CGGGGGAAGAAAGCTAGGGAAGG - Intergenic
927537736 2:23877475-23877497 CAGAGCAAGAAGGAAGGGAAGGG + Intronic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
927943964 2:27123664-27123686 GAGGGGAAGAAGGCAGGGGAGGG + Intergenic
928108444 2:28488178-28488200 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
928177810 2:29046882-29046904 TAGAGGAAGAAGAATGGAGAAGG - Intronic
928237640 2:29558553-29558575 CAGGGGAAGAAGGGCAGAGAGGG - Intronic
928300650 2:30121331-30121353 GAAGGGGAGAAGGAAGGGGAAGG - Intergenic
928713982 2:34039109-34039131 AGAGGGAAGAAGGAGGGGGAAGG - Intergenic
929037604 2:37709505-37709527 CCAGGGAAGGTGGATGGGGAGGG + Intronic
929092565 2:38233983-38234005 CAGTGGAGGGAGGCTGGGGAGGG - Intergenic
929252962 2:39779365-39779387 GAGGGGGAGAGGGAGGGGGAAGG + Intergenic
929431740 2:41893198-41893220 CCGGGGAGGGAGGAAGGGGAAGG - Intergenic
929480508 2:42302822-42302844 CAGGGAAAAAAGGCTGGGCATGG - Intronic
929497880 2:42462358-42462380 CAGGTGATGAAGGACTGGGATGG + Intronic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930254298 2:49071793-49071815 CAACGGATGAAGGATGAGGAAGG + Intronic
930561282 2:52962517-52962539 CAAGTGTAGTAGGATGGGGAAGG - Intergenic
931181149 2:59901962-59901984 CAAGGGAAGAAGGCAGGGCAGGG - Intergenic
931205343 2:60140846-60140868 GAGGAGGAGAAGGAGGGGGAGGG - Intergenic
931576219 2:63721710-63721732 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
931628466 2:64277777-64277799 GAAGGGAGGAAGGAAGGGGAAGG - Intergenic
931660640 2:64559280-64559302 TAGGGAGGGAAGGATGGGGAGGG + Intronic
931822039 2:65961877-65961899 CAGGTGATGAGGGATGGAGAAGG + Intergenic
931826284 2:66004146-66004168 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
932090695 2:68803749-68803771 CAGAGGAGAAAGGATGGGAAAGG + Intronic
932112876 2:69017423-69017445 CAGGGGAAGAAGGAGTTGCAGGG - Intronic
932385268 2:71326563-71326585 CAGAGGAAGAATGAAGAGGAAGG - Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932692099 2:73921717-73921739 TAGGGGTGGAAGGATGGGGAAGG - Intergenic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
932831049 2:74990612-74990634 AAGGGGCAGAAGGAGGGAGAGGG - Intergenic
932883017 2:75521732-75521754 CTGGGGAAGGATGATGGTGATGG + Intronic
932891259 2:75598935-75598957 AAGGGCAAGAATGATGTGGAAGG - Intergenic
933462601 2:82607730-82607752 GAGGAGAAGAAGGATTGGGATGG - Intergenic
933699350 2:85243612-85243634 CAGGAGGAGAAGGCTGGGGATGG + Intronic
934040265 2:88122463-88122485 CAGGGGCAGAAGGTAGAGGAAGG - Intergenic
934124200 2:88870681-88870703 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934553740 2:95276894-95276916 CTGGGGAGGCAGGATGGGAATGG + Intronic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
934925925 2:98381731-98381753 TGGGGGAAGGAGGCTGGGGAAGG + Intronic
935170313 2:100606491-100606513 CAGAGAAAGGAGGCTGGGGAGGG - Intergenic
935184030 2:100715526-100715548 CTAGGGAAGAAGTATGTGGATGG + Intergenic
935204218 2:100883640-100883662 CAGGTAAACATGGATGGGGAAGG - Intronic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
936154106 2:110037169-110037191 AAGGGGAAGAAGCAGAGGGAGGG - Intergenic
936190578 2:110334246-110334268 AAGGGGAAGAAGCAGAGGGAGGG + Intergenic
937509843 2:122583065-122583087 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
938178942 2:129162513-129162535 GAGGGGCAGAAGGAGGAGGAAGG + Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938971471 2:136437128-136437150 CTGGGGGAGGAAGATGGGGAGGG + Intergenic
939078437 2:137630425-137630447 ATGGGGAAGAAGTTTGGGGATGG - Intronic
939347122 2:140979948-140979970 GAGGCGAAGAAGGGTTGGGAGGG - Intronic
939419240 2:141944379-141944401 AAGAGGAATAAGGATAGGGAAGG - Intronic
939629017 2:144512834-144512856 CAGAGAAAAAAGGATGGAGATGG + Intronic
939964024 2:148592947-148592969 TGGGGCAAGCAGGATGGGGAAGG + Intergenic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
940787208 2:157994301-157994323 GAGAGGAAGAGGGGTGGGGAGGG + Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941186190 2:162324333-162324355 CAGGGGAAGTCAGAAGGGGATGG + Intronic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941584667 2:167342684-167342706 CAGAGGAACAAGGATGGGGAGGG - Intergenic
941615885 2:167718809-167718831 CAGGGGAGAAAGGAGGGAGAAGG + Intergenic
941642031 2:167999091-167999113 ATTGGGAATAAGGATGGGGAGGG - Intronic
941751686 2:169141307-169141329 CAGAGGAAGAGGGATGAGGATGG - Intronic
941901838 2:170686338-170686360 GAGGGGAAGAAAGGAGGGGAGGG + Intergenic
942135976 2:172925938-172925960 GAGGGAAGGAAGGAGGGGGAGGG + Intronic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942357998 2:175140477-175140499 CAGGAGTAGAAGGAGTGGGAGGG + Intronic
942495205 2:176532829-176532851 TAGGGGAAGAAAGTTTGGGAAGG - Intergenic
942710287 2:178827497-178827519 CAGGGGTCGAGGGAGGGGGAAGG - Intronic
942843691 2:180397087-180397109 TAGGGCAAGAAAGATGGGAATGG + Intergenic
942897668 2:181076930-181076952 GAAAGGAAGAAGGAAGGGGAGGG - Intergenic
942924083 2:181411492-181411514 CAGCTGAAGAAGGATGGGTCAGG - Intergenic
943320701 2:186438955-186438977 CAAAGGAAGAAGGATGGGTTGGG - Intergenic
943330415 2:186552099-186552121 TAGGGGAAGCAGGATAGGGTGGG + Intergenic
943619262 2:190129858-190129880 CAGAGGAAGAAGGACAGAGAAGG - Intronic
943703643 2:191013012-191013034 CGGGGGAAGGTGGGTGGGGAGGG + Intronic
943775200 2:191757980-191758002 CAGGTGAAAATGGAGGGGGAGGG + Intergenic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
943846941 2:192661724-192661746 CAGGGGAATAGGGATAGAGATGG + Intergenic
944100374 2:196019937-196019959 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944542752 2:200769184-200769206 CGTGGGAGTAAGGATGGGGATGG - Intergenic
944604749 2:201342554-201342576 CAGTGGAAGAGGGGTGGGAAGGG - Intronic
944822432 2:203444047-203444069 AAGGGAGAGAAGGAAGGGGAGGG + Exonic
944881857 2:204020841-204020863 CTGGGGTAGAAGGAAGGTGAGGG + Intergenic
945401046 2:209383097-209383119 CAGGGGAAAAAGGGTAGGGAGGG - Intergenic
945530636 2:210950114-210950136 CAGAGGGAGAGGGAGGGGGAGGG - Intergenic
946172991 2:217906300-217906322 GGGGAGAAGAAGGATGGGGCTGG - Intronic
946375082 2:219302971-219302993 CAGGGGAAGAGAGATGGGCTGGG + Intronic
946406288 2:219493661-219493683 GAGGGGAAGATGGCTGGTGAGGG + Intronic
946565217 2:220956858-220956880 GAGGGCAAGTAGGATGGTGAGGG - Intergenic
946699458 2:222397163-222397185 GAGAGGAAGAATGATGAGGAGGG - Intergenic
946909259 2:224443723-224443745 CAGAGGGAGGAGGATGGGGTAGG - Intergenic
947030005 2:225782860-225782882 GAAGGGAGGAAGGAAGGGGAAGG - Intergenic
947030207 2:225783503-225783525 GAGGGAAGGAAGGAAGGGGAAGG - Intergenic
947054071 2:226080449-226080471 AAGGGGAAGAAGGCTGTGGCAGG + Intergenic
947508039 2:230724933-230724955 CAAGGGAAAAAGGACGGGGGAGG + Intronic
947511011 2:230754397-230754419 AAGGGGAAGAAGGAGGGGAAGGG - Intronic
947511018 2:230754415-230754437 AAGGGGAAGAAGGAGGGAAAGGG - Intronic
947511024 2:230754433-230754455 AAGGGGAAGAAGGAGGGGAAGGG - Intronic
947511031 2:230754451-230754473 GAGGGGAAGAAGGAGGGAAAGGG - Intronic
947586152 2:231358173-231358195 CAGGGTATGAATGAGGGGGAGGG + Intronic
947636948 2:231684987-231685009 GAGGAGGAGGAGGATGGGGAAGG + Intergenic
948088239 2:235268132-235268154 GAGGAGAGGAGGGATGGGGAAGG - Intergenic
948258945 2:236588954-236588976 CCGGGGATGAGGTATGGGGATGG + Intergenic
948706312 2:239795602-239795624 TAGGGGAAGAGGGATGGGGAGGG - Intronic
948760013 2:240184512-240184534 CTAGGGAAGAAGGTAGGGGATGG - Intergenic
948790246 2:240373046-240373068 AAGCGGCAGAAGGAAGGGGAAGG + Intergenic
948856284 2:240732045-240732067 GAGGGGATGAGGGATGGGGGAGG + Intronic
1168900312 20:1358306-1358328 CATGGGAAGAAGGAGGAGGGAGG + Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1168958336 20:1850077-1850099 GTGGGGAAGGAGGATGGGGTTGG + Intergenic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169311068 20:4540473-4540495 CAGGGCATGAAGGAAAGGGAGGG + Intergenic
1169920617 20:10730955-10730977 AAAGGGAGGAAGGAAGGGGAGGG - Intergenic
1170160459 20:13304861-13304883 GTGGGGAAGAGAGATGGGGAAGG - Intergenic
1170509023 20:17057998-17058020 GAGGGGAAGAAGGAAGGGAAGGG + Intergenic
1170756670 20:19212057-19212079 CAGGGGAAGAGGGACGGCGCAGG - Intergenic
1170786126 20:19469185-19469207 CTGGGGATGAAGGATGTGCATGG + Intronic
1170799963 20:19582890-19582912 AAGGTGAAGTCGGATGGGGAGGG + Intronic
1170957411 20:20993851-20993873 GGAGGGAAGAAGGATGGGGAGGG + Intergenic
1171159656 20:22909612-22909634 CAGGGGAAGAAAGCTGGGGGAGG + Intergenic
1171183911 20:23111387-23111409 CAGGGGAAGGGAGATGGGGAAGG + Intergenic
1171293347 20:23995012-23995034 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171848670 20:30292687-30292709 GAGGGGGAGAGGGAGGGGGAGGG + Intergenic
1172037492 20:32019978-32020000 GAGGGGAAGACGGAGGGGGAAGG - Intronic
1172113947 20:32562943-32562965 GAGGGGAGGGAGGGTGGGGAGGG + Intronic
1172387864 20:34546748-34546770 CAGCTGATGGAGGATGGGGATGG + Intergenic
1172445320 20:34990354-34990376 CAGGGGGTGAAGGACGGGGCTGG - Intronic
1172479611 20:35263391-35263413 CAGGAGAGGAAGGGTGGGGGTGG - Intronic
1172486960 20:35304150-35304172 GAGGAGAGGAAGGAAGGGGACGG + Intronic
1172523915 20:35586090-35586112 CTGGGGATGAATGATGGGGATGG - Intergenic
1172525323 20:35597499-35597521 CAGGGGAAGGAGGATGATGGTGG - Intergenic
1172536164 20:35675005-35675027 CAGGGGAAGAAGTTGTGGGAGGG + Intronic
1172791767 20:37510774-37510796 GAGGGGAAGAAGGAGGTGGAGGG - Intronic
1172872907 20:38146973-38146995 CAGGGGGTGAAAGCTGGGGAGGG + Intronic
1173002025 20:39111584-39111606 GAGGGGAGGAAGGAGGGGGGAGG + Intergenic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173134210 20:40424938-40424960 GAGGAGGAGAAGGATGGAGATGG + Intergenic
1173252968 20:41374314-41374336 CATGGGGGGAAGGAAGGGGAGGG + Intergenic
1173410356 20:42804271-42804293 CAGGGGAGGAGGGCTAGGGATGG - Intronic
1173423145 20:42920442-42920464 GAGGGAGAGAAGGAAGGGGAGGG + Intronic
1173440055 20:43067990-43068012 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173440086 20:43068064-43068086 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173440096 20:43068086-43068108 GAGGGGAGGAAGGAAGGGGAGGG + Intronic
1173465956 20:43281620-43281642 GAGGGGAAGTGGGATGGGGAAGG - Intergenic
1173690587 20:44957976-44957998 CACAGGGATAAGGATGGGGATGG - Intronic
1173775128 20:45698985-45699007 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
1173965255 20:47107786-47107808 AAGAGGAAGAAGGAAGGGAAGGG + Intronic
1174012862 20:47464667-47464689 CAGGGGAAGGAGAATGGAAAAGG - Intergenic
1174047500 20:47743977-47743999 AAAGGCAAGAAGGAAGGGGAGGG - Intronic
1174072048 20:47906153-47906175 CAGGGCAGGAAGGTTGGGGGTGG - Intergenic
1174085410 20:48004552-48004574 CAAGGGAAGAAGGCAGGGGTTGG + Intergenic
1174137825 20:48392885-48392907 GAGGGGATGGAGGATGGGAAGGG + Intergenic
1174143628 20:48434907-48434929 CTTGGGAAGGAGGATGGGGTTGG - Intergenic
1174179094 20:48663792-48663814 CAGGGGAAGGAGGATATGGCTGG - Intronic
1174287537 20:49483492-49483514 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
1174385765 20:50187758-50187780 CAGGGGGTGGAGGGTGGGGAAGG + Intergenic
1174564079 20:51452268-51452290 CAGGGGAAGGAGACTTGGGAAGG - Intronic
1174707054 20:52667691-52667713 AAGTGGAAGAAGGATGGGAAAGG - Intergenic
1175541709 20:59751895-59751917 CAGGGCAAGGGGGCTGGGGAAGG - Intronic
1175676303 20:60949385-60949407 CCGGGGAGCAAGGAAGGGGAAGG - Intergenic
1175755724 20:61528453-61528475 GAGGGGGAGAGGGAGGGGGAGGG + Intronic
1175874302 20:62222147-62222169 CAGGGGAGGAGGGGTGGGGAGGG - Intergenic
1175924323 20:62464634-62464656 CAGAGCAAGAAGGCTGGTGAGGG - Exonic
1176090536 20:63316482-63316504 CAGGGGAGGGAGGAAGGGGCAGG - Intronic
1176090554 20:63316530-63316552 CTGGGGAAGATGGTGGGGGAAGG - Intronic
1176161282 20:63650207-63650229 AAGGGGAAGGATGGTGGGGAGGG - Intronic
1176270518 20:64233451-64233473 AAGGGGAGGAAGGTGGGGGAAGG - Intronic
1176367536 21:6043069-6043091 AAGGGGAAGAATGATGGAGACGG - Intergenic
1176415383 21:6471665-6471687 CAGGGGAAGAGCGCTGGAGATGG + Intergenic
1176648331 21:9371455-9371477 CTGGGAAATAAGAATGGGGAGGG - Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1177012470 21:15745050-15745072 CAGGAAAAGAAGGAGTGGGAAGG - Intronic
1177538066 21:22455167-22455189 GAGGAGGAGAAGGAAGGGGAAGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178295375 21:31405449-31405471 CAGGGGAAGTGGGCTCGGGAAGG - Intronic
1178305911 21:31489810-31489832 CAGATGAAGTGGGATGGGGAGGG - Intronic
1178322278 21:31614736-31614758 CAGGGGAATAGGGAGGGGAAGGG + Intergenic
1178516001 21:33247678-33247700 CAGGGAAAGAAAGAAGGGGTAGG - Intronic
1179025183 21:37673817-37673839 CAGTGGAGGAAAGAAGGGGAAGG + Intronic
1179046631 21:37850556-37850578 CAGGGGCAGGAGGAGGGGGTGGG - Intronic
1179291217 21:40019926-40019948 AAGGGAAAGAAGGAGGGAGAAGG - Intronic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179417662 21:41211166-41211188 AGGGGGGAGAGGGATGGGGAGGG - Intronic
1179480936 21:41678256-41678278 GGGGAGAAGAAGGTTGGGGAGGG + Intergenic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179628376 21:42661382-42661404 CTGGGGGAGGGGGATGGGGAGGG - Intronic
1179690883 21:43079998-43080020 CAGGGGAAGAGCGCTGGAGATGG + Intergenic
1179755983 21:43495473-43495495 AAGGGGAAGAATGATGGAGACGG + Intergenic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1180090766 21:45532940-45532962 CAGGGGAAGAAAGACAGGAAGGG + Intronic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1180824408 22:18852727-18852749 ATGGGGAAGGAGGTTGGGGAGGG + Intronic
1180938287 22:19640286-19640308 CAAGGGGAGGAGAATGGGGATGG - Intergenic
1180951129 22:19721158-19721180 CATGGGAAGAGGGTTGGGGTTGG - Intronic
1181096932 22:20511767-20511789 TGGGGGAAGAAGGATGGGACTGG - Intronic
1181124833 22:20695881-20695903 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181188326 22:21121821-21121843 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181210872 22:21288672-21288694 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181398636 22:22638216-22638238 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181471959 22:23145975-23145997 CAGTGGAAGTAGAGTGGGGAGGG - Intronic
1181501369 22:23317572-23317594 ATGGGGAAGGAGGTTGGGGAGGG - Exonic
1181650784 22:24257843-24257865 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
1181706598 22:24652896-24652918 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1181789219 22:25250501-25250523 AAGGGAAAGAAGGAAGGAGAAGG - Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182048956 22:27298777-27298799 GAGGGGAAGAGGGAGGGGGCAGG + Intergenic
1182151251 22:28028617-28028639 GAAGGGAAGAAGGATGAGGGAGG + Intronic
1182399644 22:30066041-30066063 GAGGGGGAGAGGGAGGGGGAGGG - Intergenic
1182418689 22:30238048-30238070 CAGGGCCAGGTGGATGGGGAGGG - Intergenic
1182886395 22:33777636-33777658 GAGGGGAAGGGGGAGGGGGAGGG + Intronic
1182936393 22:34226441-34226463 CAAGGTAAGAAGGATGGGGAAGG + Intergenic
1183227460 22:36560303-36560325 GAGTGGCAGAAGAATGGGGAGGG - Intergenic
1183264489 22:36816906-36816928 CGAGGGGAGAGGGATGGGGAGGG + Intronic
1183276469 22:36901195-36901217 GAGGGGAACAGGGATTGGGAAGG - Intergenic
1183324520 22:37184118-37184140 CTGGGGAAGCTGGGTGGGGAGGG + Intronic
1183381246 22:37491591-37491613 GAGGGGGAGAAGGAGGGGGGAGG + Intronic
1183421719 22:37715668-37715690 GAGGGGCAGAAGGAAGGGAAGGG - Intronic
1183618529 22:38959455-38959477 CAAGGGAGGAAGTGTGGGGAGGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183686686 22:39365075-39365097 CAGGGGAGGATGGAGGGTGATGG - Intronic
1183729162 22:39607581-39607603 AAGGGGAAGAGAGATAGGGAGGG + Intronic
1183901298 22:41008049-41008071 CAGAGGAAGAAGGATGGATTGGG - Intergenic
1183914855 22:41109725-41109747 CAGGGGGAGGAGGACGGGAACGG + Intronic
1184049885 22:41996737-41996759 CAGGGGAAGATCTATGGGCATGG + Intronic
1184075728 22:42176295-42176317 AAGGGCAAGAAGGATGTGAAAGG + Intronic
1184092484 22:42299829-42299851 AAGGGGGAGAAGGAAGCGGAGGG + Intronic
1184159969 22:42692285-42692307 GAGAGGAAGAAGGATGGGGTGGG + Exonic
1184333437 22:43840105-43840127 CAGAGGAGGAAGGAAGGGGTGGG + Intronic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184457761 22:44621160-44621182 CAGGGACACAACGATGGGGATGG + Intergenic
1184499670 22:44863983-44864005 CATGGGGACAGGGATGGGGAGGG + Intergenic
1184550323 22:45200954-45200976 CAGGTGAAGAAGGGGGGGAAGGG + Intronic
1184584936 22:45441528-45441550 CATGGGGTGAAGGTTGGGGATGG + Intergenic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1185148012 22:49149773-49149795 GAAGGGAAGGAGGCTGGGGAGGG + Intergenic
1185345177 22:50307756-50307778 GAGGGGGAGAAGGAGGGGGAGGG + Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1185372038 22:50465427-50465449 GAGGGGCAGAAGGATGGGAGCGG - Intronic
1203216075 22_KI270731v1_random:6758-6780 ATGGGGAAGGAGGTTGGGGAGGG - Intergenic
1203274546 22_KI270734v1_random:78631-78653 ATGGGGAAGGAGGTTGGGGAGGG + Intergenic
949960160 3:9305194-9305216 AAGGGGAGGAAGGATTGGGCAGG + Intronic
950014710 3:9747467-9747489 CAGGGGAAGCTGGGTGGGGGAGG + Exonic
950168894 3:10822588-10822610 CAGGGGAGGGAGGTTGGGGAAGG + Intronic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950383590 3:12638031-12638053 AAAGAGAAGAATGATGGGGAAGG - Intronic
950472234 3:13193464-13193486 TGGGGGATGAAGGATGTGGACGG + Intergenic
950528926 3:13541201-13541223 AAGGGGAAGAAGGACTGGGCAGG + Intergenic
950994782 3:17483299-17483321 TAGGGGAGGAAGTATGGGGTGGG - Intronic
952013680 3:28931947-28931969 CAGGGGAAGCAGGATGGTCCTGG - Intergenic
952273778 3:31857846-31857868 GAGGGAAAGAAGGAGGGAGAGGG + Intronic
952415261 3:33084232-33084254 CAAGGGGAGAGGGAAGGGGATGG + Intronic
952565472 3:34652376-34652398 CAGGGGAAGGATGAGCGGGACGG - Intergenic
952711788 3:36439101-36439123 CAGTGGAAAGAGCATGGGGACGG + Intronic
952717962 3:36500443-36500465 CAGGCGAAGGAGGTAGGGGAGGG + Intronic
952877009 3:37954577-37954599 CAGAGGAAGAAGGAAGGCCATGG + Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
952978575 3:38717166-38717188 GAGGGAAAGAAGAATGGGAATGG + Intronic
953244048 3:41174840-41174862 GAGGGGAAGAAGGAGGGAGTGGG + Intergenic
953289804 3:41649656-41649678 CATGGGAAGAAGGCTGGGTGGGG + Intronic
953355728 3:42254850-42254872 GAGGGGAAGAGGGATGGAGGGGG + Intergenic
953383561 3:42492193-42492215 TAGGGGAGGAGGGATGAGGAAGG - Intronic
953420523 3:42750248-42750270 CTGGAGAAGGAAGATGGGGAAGG - Intronic
953489406 3:43336214-43336236 GAGGGGAGGAAGGAAAGGGAGGG - Intronic
953625778 3:44569722-44569744 CAGGAAAACAAGGAAGGGGAAGG - Intronic
954090352 3:48279217-48279239 AAGGGGATGAAGGATTTGGAGGG - Intronic
954197293 3:49004290-49004312 CAGGGGGAGAAGACTGGGCAGGG + Intronic
954330781 3:49889154-49889176 CAAGGGAAGAAGGACTGGGCAGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954411854 3:50374334-50374356 TAGGGGGAGGAGGAGGGGGAAGG + Intronic
954487972 3:50872762-50872784 AAGGGGAGGAAAGAAGGGGAAGG - Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954740825 3:52749086-52749108 AAGGGGAAGAGGGGAGGGGAGGG + Intronic
954770960 3:52968281-52968303 CAGGGGAAGGAGGATAGGTGTGG + Intronic
954901837 3:54026596-54026618 TAGGGGAAGAAGTACGTGGAGGG - Intergenic
955670234 3:61394384-61394406 GAGGGGGAAAAGGAGGGGGAGGG + Intergenic
955672134 3:61412740-61412762 GAAGGGAAGAAGGAAAGGGAAGG + Intergenic
955774087 3:62415096-62415118 GAGGGAAAGAAGTATGGGGCGGG - Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956191220 3:66610280-66610302 CAGGGGCAGGAGGATGTGCATGG + Intergenic
956302228 3:67784631-67784653 CAGGGGAAGAATTAGGAGGATGG + Intergenic
956376917 3:68623112-68623134 CAGGGGACTAAGGGTGGGGCAGG - Intergenic
956412719 3:68995277-68995299 CAGGGTAGGTTGGATGGGGATGG - Intronic
956413484 3:69003090-69003112 GAGGGGGAGGAGGACGGGGAGGG - Intronic
956543949 3:70378442-70378464 TATAGGAAGAAGGATGAGGAAGG + Intergenic
956664640 3:71631044-71631066 AATGGGAAGAGGGATGAGGAAGG - Intergenic
956849697 3:73217711-73217733 AGGGGGAAGAGGGAAGGGGAGGG - Intergenic
956913985 3:73851474-73851496 GAGGGGAAGTATGATAGGGAAGG + Intergenic
957229506 3:77493725-77493747 GAGGGGATGAAGCATGGGAACGG - Intronic
957523038 3:81345570-81345592 AAGGGGAAGGTGGATGGAGATGG + Intergenic
957887378 3:86305355-86305377 AAATGGAAGAAGGAAGGGGAGGG - Intergenic
958005080 3:87800240-87800262 CAGAGGAAGAAGGACTTGGAAGG - Intergenic
958431170 3:94043551-94043573 GAGGGGAAGAGGGAGGGGGGAGG - Intronic
959651614 3:108756339-108756361 CAGGGAAACAAGAATGGGCAAGG + Intronic
959695184 3:109241534-109241556 CAGGGGAAGAAGAAGGGTGGGGG + Intergenic
959716472 3:109439058-109439080 AAGGGGAAGAAAGAAGGGAATGG - Intergenic
960195277 3:114759298-114759320 CAGTGGAAAGGGGATGGGGAGGG + Intronic
960349610 3:116576331-116576353 TTGGGGAAGAAGTATGTGGATGG + Intronic
960455059 3:117860764-117860786 TAAGGGATGAAGGATAGGGAAGG - Intergenic
960506372 3:118499795-118499817 CTGGGGAGGAAGGCTGGGGAAGG - Intergenic
960598949 3:119435977-119435999 CAGGGGGAGAGGGAAAGGGAAGG + Intronic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961345539 3:126260957-126260979 GAGGGGGAGAAGGAAGAGGAGGG - Intergenic
961481507 3:127183734-127183756 GAGGGGGAGAGGGAGGGGGAGGG - Intergenic
961651785 3:128420592-128420614 CAAGGAAAGAAGGACGTGGAGGG - Intergenic
961668501 3:128509204-128509226 CATGGGAAGAAGCATGTGCATGG - Intergenic
961831506 3:129625350-129625372 CACTGGAAGACAGATGGGGAAGG - Intergenic
962079788 3:132125842-132125864 CAGGCAACGAAGGATGGGCAAGG - Intronic
962108436 3:132417387-132417409 CAGGGAAAGAACGATCGGGACGG + Intergenic
962254570 3:133861596-133861618 CAGGGCATGAAGGACAGGGAGGG - Intronic
962681081 3:137801070-137801092 AAGAGGAAGAGGGTTGGGGAAGG + Intergenic
962869135 3:139473050-139473072 CAGGCGATGAAGGAATGGGAGGG - Intronic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
963748754 3:149152473-149152495 CAGTGGAGGTAGGAGGGGGAAGG + Intronic
963771750 3:149393296-149393318 CAGAGGAAGTAGCATGGGAAAGG - Intergenic
963884627 3:150567529-150567551 CAGTGGAAAAAGCATGGGGTAGG - Intronic
963938869 3:151081439-151081461 CAGGGGAAGTGGGAGGGGGAGGG - Intergenic
964473913 3:157081985-157082007 CCGGAGAACAAGGCTGGGGAAGG - Intergenic
964671353 3:159229735-159229757 GAGGGGGAGGAGGATGGGGGAGG - Intronic
964763165 3:160153401-160153423 GAGGCCAAGAAGGATGGAGAAGG - Intergenic
965147993 3:164931053-164931075 CAGGGGATGGAGAGTGGGGATGG + Intergenic
965742121 3:171886510-171886532 GAAGGGAAGAAGGAAGGGCATGG - Intronic
965897256 3:173593620-173593642 CAGGAGAAAACTGATGGGGAAGG + Intronic
966225269 3:177591152-177591174 CAGGGAAAGAAGGAAGGGCAGGG + Intergenic
966318784 3:178677779-178677801 AAGGGGGAGAAGGATGGGACAGG + Intronic
966350803 3:179031953-179031975 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966350813 3:179031971-179031993 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966350829 3:179032001-179032023 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966530364 3:180972134-180972156 GAGGGGAGGAAAGAAGGGGAAGG - Intronic
966908524 3:184544619-184544641 GAGGGGGAGAAGGAGGAGGAGGG - Intronic
967192672 3:186998553-186998575 CAGAGGTAGAAGGAGGGCGAGGG + Intronic
967316876 3:188158060-188158082 CAGGAGAATAAGGCTGGGTAGGG + Intronic
967350672 3:188511035-188511057 GAGAGGGAGAAGGAAGGGGAGGG - Intronic
967684027 3:192398874-192398896 CAGAGGAAGAAGGATTCTGAAGG - Intronic
967717717 3:192782337-192782359 CCGGGGAAGGTGGGTGGGGAGGG + Intergenic
967977484 3:195043698-195043720 GGGGGGAAGAGGGATGGGGATGG - Intergenic
968339312 3:197941467-197941489 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
1202738551 3_GL000221v1_random:33529-33551 CTGGGAAATAAGAATGGGGAGGG + Intergenic
968462474 4:732322-732344 GAGGGGAGGAGGGAAGGGGAGGG - Intronic
968565773 4:1311953-1311975 GAGAGGAAGGAGGATGGTGAGGG - Intronic
968729858 4:2264581-2264603 CAGGAGGAGAGGGAAGGGGAGGG + Intergenic
968741336 4:2333156-2333178 CAAGGGAGGGAGGTTGGGGAGGG - Intronic
968844032 4:3029816-3029838 CAGTGGCAGGAGCATGGGGAAGG - Intronic
968861057 4:3170471-3170493 CAGGGAAAGAAGCATTGGAAAGG - Intronic
968889370 4:3359374-3359396 GAGGGGGAGGAGGAAGGGGAGGG - Intronic
968924858 4:3541795-3541817 GATGGGTAGATGGATGGGGATGG + Intergenic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969107884 4:4821615-4821637 CAGAAGAAGAAGGAAGGTGAGGG + Intergenic
969130156 4:4985173-4985195 CAGGGATGGCAGGATGGGGAGGG + Intergenic
969257239 4:6010795-6010817 CAGGGGAAGGACGATGGGGCTGG - Intergenic
969275237 4:6130198-6130220 CAGGGGAAGAAGGAGGGAGCGGG + Intronic
969315211 4:6377730-6377752 CAGGTGAAGGAGGATGGGCAGGG + Intronic
969334452 4:6499363-6499385 AAGGGAGAGAAGGATGGGGTGGG - Intronic
969370312 4:6727626-6727648 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969562651 4:7959482-7959504 GAGGGGATGAAGGCTGGGGTCGG - Intergenic
969651214 4:8469378-8469400 CAGAGGAAGAAGGCTGAGGCTGG + Intronic
969658337 4:8510658-8510680 CAGGGGAAGAGGGCCCGGGAGGG + Intergenic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
969867023 4:10082879-10082901 CAGGAGAACAATGCTGGGGACGG + Intronic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970023267 4:11592933-11592955 CAAGGGAAGAAGAGTGGGAAAGG - Intergenic
971000000 4:22311304-22311326 GATGGGACGAAGTATGGGGAAGG + Intergenic
971136443 4:23873402-23873424 CATTGGAAGAAAGATGAGGAAGG + Intronic
971167492 4:24199027-24199049 CAGGGAAAGAAGGAAGAGTAGGG - Intergenic
971265279 4:25091444-25091466 CAGGGGAGGAAGAAGGGGCAGGG - Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
973330068 4:48904026-48904048 TAGGGAAAATAGGATGGGGAAGG - Intronic
973870950 4:55165814-55165836 CAGTGGAAGCTTGATGGGGATGG + Intergenic
974228122 4:59075247-59075269 AAGGAGAAGAAGGAAGGGAAGGG + Intergenic
974374799 4:61062214-61062236 GAGGGAAGGAAGGAAGGGGAAGG + Intergenic
974597688 4:64036622-64036644 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975360214 4:73460931-73460953 GAGGGGAAGGAGGAGGGGAAGGG - Intergenic
975411912 4:74062766-74062788 CAGAGGAAGAAAAATGGGAAAGG - Intergenic
975467507 4:74724975-74724997 AAGGGGAAAAAGGAAGGGGTTGG - Intergenic
975969644 4:80017675-80017697 AATAGGAAGAAGGATGAGGAAGG + Intronic
976177913 4:82373381-82373403 CGGGGGAATAAAGAGGGGGAGGG + Intronic
976353321 4:84085047-84085069 TAGGGGAAGAAGGAGGGGATGGG - Intergenic
976957680 4:90922299-90922321 AAGGAGAAGAGGGAAGGGGAAGG + Intronic
977240073 4:94557448-94557470 CAGTGGTAGTTGGATGGGGATGG + Intronic
977628469 4:99215210-99215232 TAGGGGATGTAGGATGGAGAAGG + Intronic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
977820197 4:101462384-101462406 AAAGGGAAGGATGATGGGGAGGG + Intronic
978005169 4:103606367-103606389 CAGTGGTAGTTGGATGGGGATGG + Intronic
978702318 4:111662607-111662629 GAGGGGGAGGGGGATGGGGAGGG + Intergenic
979354798 4:119690738-119690760 CAGGGAGCAAAGGATGGGGAAGG + Intergenic
979506404 4:121502617-121502639 GAGGGAAGGAAGGAGGGGGAGGG - Intergenic
979700244 4:123658744-123658766 CAGAGGGGGAAGGATGAGGAGGG + Intergenic
980191190 4:129527449-129527471 CAGAGGAAGGAGGATGGAGGTGG + Intergenic
980313273 4:131163112-131163134 TAGAGGAAGAAGGATTGTGACGG + Intergenic
980329876 4:131397794-131397816 CAGGGGTTGGGGGATGGGGAAGG - Intergenic
981011941 4:139933858-139933880 CAAAGGAAGAGGGATGGGGTGGG + Intronic
981329266 4:143488971-143488993 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
981532435 4:145765353-145765375 ATGGGGTGGAAGGATGGGGAGGG - Intronic
981703093 4:147628198-147628220 CAGTGGCAGAAGAATGTGGATGG - Intronic
981716633 4:147758595-147758617 CAGGGGACAAAGAATGGAGAAGG - Intronic
982205075 4:152991586-152991608 CAGGGAAAGAGGGATGTGGGGGG + Intergenic
982297874 4:153848546-153848568 CAGTGGAAGAAGGAGCTGGAGGG - Intergenic
982683505 4:158460009-158460031 CAGGGGATGAGGGATGGGACGGG + Intronic
983273955 4:165595033-165595055 TAGGAGAAGAAGGATTGAGAGGG + Intergenic
983296440 4:165873892-165873914 CCGGGGGAGGAGGATGGGGTTGG + Exonic
983582766 4:169325442-169325464 TTGGGGAAGAAGTATGTGGATGG + Intergenic
984220401 4:176967568-176967590 CAGGGGAAGCATGAGGGGGTGGG + Intergenic
984225778 4:177033078-177033100 CCGGGAGAGAAGGATGTGGAGGG + Intergenic
984551750 4:181169028-181169050 CTGGGGTAGAAGGAGGGTGAAGG - Intergenic
984617545 4:181915662-181915684 GAGGGGAGGACGGAAGGGGAGGG + Intergenic
984760338 4:183357651-183357673 CAGGTGAGGAGAGATGGGGATGG + Intergenic
984963716 4:185122765-185122787 CAGTGGATGAAGGAAAGGGAAGG - Intergenic
985140940 4:186840379-186840401 AAGGAGGAGAAGGAGGGGGAGGG - Intergenic
985141013 4:186840624-186840646 GAGGGGGAGAAGGAGAGGGAGGG - Intergenic
985258372 4:188091842-188091864 CATGGGCAGCAGGATGGGGCTGG - Exonic
1202767360 4_GL000008v2_random:159722-159744 CTGGGAAATAAGAATGGGGAGGG - Intergenic
985652305 5:1112624-1112646 AGGGGGAAGAAGGAGGGGTAGGG - Intergenic
985665598 5:1180319-1180341 CAGGGTGAGATGGATGGAGACGG + Intergenic
985729443 5:1539176-1539198 CAGGGGATGTAGGCTTGGGAAGG - Intergenic
986183629 5:5416977-5416999 GAGGGGAAGGAGGACGGGGAGGG + Intergenic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
986249062 5:6039425-6039447 CAGGTAAAGAAGGCTGGGGGTGG - Intergenic
986591850 5:9378993-9379015 TAGATGAAAAAGGATGGGGATGG + Intronic
986773501 5:10994339-10994361 CCGGGGAAGGAGGAGGGGGGCGG + Intronic
986773805 5:10995982-10996004 GAAGGGAGGAAGGAAGGGGACGG + Intronic
986946669 5:13029303-13029325 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
986946681 5:13029336-13029358 AAGGGGAAGAAGAAGGGGAAGGG + Intergenic
987093174 5:14525448-14525470 CATGGGAAGAAGGATGAGGCAGG - Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987332550 5:16869919-16869941 AAGGGGAAGGGGGAGGGGGAGGG + Intronic
987334831 5:16889444-16889466 AAAGGAAAGAAGGAAGGGGAAGG + Intronic
987457955 5:18170057-18170079 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
988279327 5:29126076-29126098 CAGAGGCAGAAGAATGGGAATGG + Intergenic
988322466 5:29716567-29716589 CAGAGGAAGCAGGATAGGAAAGG - Intergenic
988412731 5:30908179-30908201 AAGGGTAAGAAGGATGGGAATGG - Intergenic
988608779 5:32705546-32705568 AGGAGGAAGAGGGATGGGGAGGG + Intronic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988857901 5:35247037-35247059 GAGAGGAAGAAAGAAGGGGAGGG + Intergenic
989204013 5:38793713-38793735 CAGATGAAGAAGGATGGGTATGG - Intergenic
989457561 5:41661138-41661160 TTGGGGAAGAAGTATGTGGATGG - Intergenic
989477740 5:41893242-41893264 GAGGGGAAGGAGGAAGGGAAGGG + Intergenic
990043300 5:51398246-51398268 CAGGGAGCGAAGGAGGGGGAGGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990589644 5:57249751-57249773 GAGGGGAAGGGGGAGGGGGAAGG - Intronic
990742532 5:58926708-58926730 CAGGGGAAAGAGGAAGGGCAGGG + Intergenic
990981674 5:61607305-61607327 CTGGGGATGAAGGATAGCGATGG + Intergenic
991368795 5:65896524-65896546 GAGGGGATGATGAATGGGGATGG + Intergenic
991658418 5:68926421-68926443 CAGAGGAAAAGGGAAGGGGAAGG + Intergenic
992071701 5:73154704-73154726 GAAGGAAAGAAGGAAGGGGAAGG - Intergenic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992465981 5:77005234-77005256 CAGGGGATGAAGAAAAGGGATGG - Intergenic
992542404 5:77777899-77777921 CAGGTGGAGGAGGTTGGGGAAGG - Intronic
993379589 5:87191341-87191363 GAGGGGAAGAATTATGGGGAGGG + Intergenic
993709013 5:91204468-91204490 CTGGAGATGAAGGATGGTGATGG + Intergenic
993741450 5:91545820-91545842 CAGGGGGTGGAGGATGGGGGAGG - Intergenic
993809638 5:92459393-92459415 CAGGGGAAGGAGGAGAGGAAGGG - Intergenic
994121480 5:96118731-96118753 CTGAGGAAGAAGGTTGGGGCTGG + Intergenic
994235900 5:97361698-97361720 CAGGGGTGGAAGGCTGGGGGAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995109627 5:108414475-108414497 AAGGGGAAAAGGGAGGGGGATGG - Intergenic
995209571 5:109521897-109521919 AGGGGGAAGAAAGAAGGGGAAGG - Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995532554 5:113106087-113106109 CAGGGGAAGGTGGATGGGTGAGG - Intronic
995591994 5:113708924-113708946 GGGAGGAAGAAGGATTGGGAAGG + Intergenic
995598196 5:113768998-113769020 TAGGGGAAGAGGGAAGGGAAAGG + Intergenic
995657287 5:114440667-114440689 CAGGGGAAGTGGGGTGGGGGTGG + Intronic
995749561 5:115440054-115440076 CAGAGGGAGAAGGGTGGAGAAGG - Intergenic
995751575 5:115458022-115458044 CATGGGAAGAAGGATTGTGCTGG + Intergenic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
996387568 5:122925179-122925201 AGGGGGAAGAAGGATGGGAGGGG - Intronic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
997444684 5:133932666-133932688 CAGAGGAAGAAGGCTGGAGCTGG - Intergenic
997630690 5:135366595-135366617 AAGAGCAAGTAGGATGGGGAGGG + Intronic
997672467 5:135686740-135686762 AAGGGAAGGAAGGATGGGAAGGG + Intergenic
997688804 5:135811213-135811235 CCTGGGAAGGAGGATGGGCAGGG + Intergenic
997883062 5:137607695-137607717 CATGGGAAGAAGGGTGTGTACGG + Intergenic
997897828 5:137735789-137735811 CAGAGGAAGGAGGATTGAGAAGG - Exonic
998028014 5:138837501-138837523 GAGGGGAGGGAGGAGGGGGAGGG - Intronic
998192758 5:140041850-140041872 CAGGAGAGGAAGGAGGGGGCGGG + Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998275940 5:140753531-140753553 CAGTGGAAGTATGATGGGGGAGG + Intergenic
998699384 5:144680355-144680377 AAGGAAATGAAGGATGGGGACGG + Intergenic
999126735 5:149251568-149251590 CAGGGGAAAAGGGAGGGGGTGGG - Intronic
999133848 5:149304558-149304580 CTGGGGCAGAAGGAAAGGGAGGG + Intronic
999149502 5:149417363-149417385 AGGAGGAAGAAAGATGGGGAGGG - Intergenic
999325167 5:150639305-150639327 CAGGGGAAGGAGGCTGGGCCTGG - Intronic
999378789 5:151105460-151105482 CAGAGGAGGAAGCATGGGGAAGG - Intronic
999404585 5:151295811-151295833 GAGTGGGAGAAGGTTGGGGATGG + Intronic
999470677 5:151852156-151852178 AGGGTGAAGAAAGATGGGGAAGG - Intronic
999679670 5:154045056-154045078 AAGGACAAGAGGGATGGGGAAGG - Intronic
999721510 5:154402222-154402244 AAGGGGAAGAGGGATGGGAGGGG - Intronic
999833321 5:155341598-155341620 CAGAGAGAGAAGGATGAGGAAGG + Intergenic
1000027333 5:157370851-157370873 CAGGGGACGGAGGAAGGGGTTGG + Intronic
1000091068 5:157930100-157930122 GAGGGGAAGAAGGGGGAGGAAGG + Intergenic
1000113872 5:158135215-158135237 CAGGAGAAAGGGGATGGGGAAGG + Intergenic
1000114767 5:158143347-158143369 CAGTGGAGGAAGGCTGGGTAGGG + Intergenic
1000185058 5:158851356-158851378 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1000349737 5:160343941-160343963 CAAGGGAAGCTGGATGGAGAGGG - Intronic
1000417055 5:160994530-160994552 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1001106592 5:168859806-168859828 GAGTGGGAGTAGGATGGGGAGGG + Intronic
1001238682 5:170051317-170051339 AAGGGAAGGAAGGATGGGGGTGG - Intronic
1001266215 5:170276384-170276406 GAGGGGAAGATGGAAGGAGAAGG - Intronic
1001303768 5:170556569-170556591 CAGAGGAACAAGGACAGGGATGG + Intronic
1001341578 5:170851422-170851444 CATGGGGAAAAGGGTGGGGAGGG - Intergenic
1001568449 5:172715147-172715169 CTGGGGAAGTGGGATGGGAAGGG + Intergenic
1001799616 5:174531607-174531629 CAGGGGCTGGAGGGTGGGGAAGG + Intergenic
1001803079 5:174560107-174560129 CAGTGGAAGCAGGATAGGGCAGG - Intergenic
1002071671 5:176682195-176682217 CAGGACAAGAAGGCTGGGGCAGG - Intergenic
1002101681 5:176861006-176861028 CAGGGGCAGATGGGTGTGGAGGG - Intronic
1002193707 5:177491475-177491497 GAGAGGAAGAAAGACGGGGAGGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002783440 6:384004-384026 CAGGGAAAGAAGGGTTGGCAAGG - Intergenic
1002917170 6:1538658-1538680 GAGGGGAAGAAAGATGGAGAAGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020520 6:2505190-2505212 GGGGGGAGGAAGGATGGGGGAGG - Intergenic
1003487533 6:6592507-6592529 CAGTGGAAGAAGCAGGGTGAGGG + Intronic
1003595178 6:7468332-7468354 AACAGGAAGAAGGATGAGGATGG + Intergenic
1003681974 6:8265701-8265723 AAGGGAAAAAAGGATGGGAAGGG + Intergenic
1003695808 6:8405520-8405542 TTGGGGAAGAAGTATGTGGAGGG - Intergenic
1003803948 6:9703988-9704010 CAGAGGAAGAACTCTGGGGATGG + Intronic
1003852225 6:10236970-10236992 CAGGAGACAAAGGCTGGGGAAGG - Intergenic
1003863592 6:10343786-10343808 CAGGGGAACAGGTAGGGGGAAGG - Intergenic
1003936133 6:10976951-10976973 CACAGGAAGAAGGTTGGGGAAGG - Intronic
1004150733 6:13117778-13117800 CAGGGGATGATGGATGGATATGG - Intronic
1004453484 6:15769585-15769607 CAGAGCAAGAATGATGGGGCTGG - Intergenic
1004515152 6:16316251-16316273 GATGGGAAGAGGGAGGGGGATGG - Intronic
1005006599 6:21293418-21293440 GAGGGGAAGATGGGAGGGGAAGG - Intergenic
1005067461 6:21832403-21832425 TAGGATAAGATGGATGGGGATGG + Intergenic
1005413249 6:25573141-25573163 CAAGGGGAGGAGGATGGGGAGGG + Intronic
1005630226 6:27700340-27700362 GAGGGAAAGAGGGATGGGGTGGG - Intergenic
1005647764 6:27857419-27857441 GAGGAGAAGAAGGAAGGAGAAGG + Intronic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1005934443 6:30509526-30509548 CAGGGAACCAAGGCTGGGGAGGG - Intergenic
1005943061 6:30575536-30575558 CAGGGAAACAAGGATGGAGAGGG + Intronic
1006039008 6:31238356-31238378 CGGGGGTAGAAAGATGGGAAGGG + Intergenic
1006048116 6:31317159-31317181 CAGGGGTAGAAAGATGTGAAAGG + Intronic
1006064167 6:31450336-31450358 CAGGTGAAGAAGTCTGGGCATGG - Intergenic
1006304158 6:33208755-33208777 AAGGCGAAGAAGGCTGGGGGTGG - Exonic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006562972 6:34929771-34929793 AAGGGGAAGGGGGAGGGGGAGGG - Intronic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1006738146 6:36289686-36289708 CAGGGAAAGAAGGTGGGGTATGG + Intronic
1006860571 6:37169733-37169755 CGAGGGAGGAAGGATGGGGAGGG - Intergenic
1007099998 6:39239635-39239657 CAGGGGAGGCAGGCTGGGGGAGG - Intergenic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007762864 6:44143789-44143811 CAGGGTAAGAGGGGTTGGGAAGG + Intronic
1007764439 6:44152514-44152536 CAGGGAAGGAGGGAGGGGGAAGG - Intronic
1008000199 6:46352398-46352420 GAGGGGAAGGAGGACGGGGTGGG - Intronic
1008400371 6:51056095-51056117 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1008690309 6:53971451-53971473 AAGAGGAAGAAGGAAGGTGAAGG + Intronic
1009882201 6:69582782-69582804 TAGGGGAAGAAGAATCGGAAGGG + Intergenic
1010016065 6:71105844-71105866 CTGGGGAAGAGACATGGGGAGGG - Intergenic
1010383602 6:75252004-75252026 AAGTGGAAGAAATATGGGGAGGG + Intergenic
1010653060 6:78478369-78478391 TAAGGGAAGAATCATGGGGAAGG - Intergenic
1010887421 6:81261880-81261902 GAGGGGAAGAGGAAGGGGGAGGG + Intergenic
1010995146 6:82523919-82523941 CAGGGGAAGTCAGAAGGGGAGGG - Intergenic
1011106625 6:83788888-83788910 CAGAGAATGAAGGGTGGGGAAGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012206841 6:96472220-96472242 CAGGGGAAGGGGGATTGGGGAGG - Intergenic
1012268709 6:97180432-97180454 CAGGGTAGAGAGGATGGGGATGG + Intronic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012473005 6:99591295-99591317 CAGGGGTCGGGGGATGGGGATGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1013231569 6:108165746-108165768 CACGGCAAGAAGGAAGGGGAGGG - Intronic
1014182326 6:118398744-118398766 CAGGGGATGAAGGGTGTGCAGGG - Intergenic
1014228277 6:118873166-118873188 GAAGGGAAGAAGGGAGGGGAGGG + Intronic
1014258193 6:119185410-119185432 CAGTGAAAGAAGGCTGGGAAGGG + Intronic
1014417074 6:121196018-121196040 TTGGGGAAGAAGTATGTGGATGG + Intronic
1014856071 6:126402329-126402351 CAGGAGAAGAAAGATGGAGAGGG - Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1015471645 6:133612840-133612862 CAGAGGAAGAAGCATGGAGGAGG - Intergenic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016400757 6:143677900-143677922 CGGGGGAAGAAGGGGGGTGAGGG - Intronic
1016417763 6:143851013-143851035 AGGTGGAAGAAGGAGGGGGAGGG + Intronic
1016480055 6:144471050-144471072 GAGGGGGAGAGGGAGGGGGAGGG + Intronic
1016524431 6:144985536-144985558 CAGAAGAAGAAGAATGGGAAAGG - Intergenic
1016772809 6:147870790-147870812 AAAGGGAAGAGGGAAGGGGAGGG + Intergenic
1016851879 6:148628393-148628415 CAGGGGGATAAGGATGGGGGAGG - Intergenic
1016990700 6:149925941-149925963 CAGGGCGAGGAGGATGGGGGGGG - Intergenic
1017491890 6:154952335-154952357 CAGGGGAAGAAGGATATGGAAGG - Intronic
1017637408 6:156456287-156456309 GAGGGGATGGGGGATGGGGAGGG - Intergenic
1017784323 6:157742265-157742287 CAGGGGAAGAGTGTTTGGGAAGG + Intronic
1017810069 6:157978126-157978148 CAGGGGTAGAAGGCAGGGGCAGG - Intergenic
1017920214 6:158865227-158865249 CAAAGGTGGAAGGATGGGGAAGG - Intergenic
1018111529 6:160541000-160541022 GTGGGGAGGAAGGAAGGGGAGGG + Intronic
1018163375 6:161069780-161069802 CTGGTGAGGAATGATGGGGAGGG + Intronic
1018285219 6:162230443-162230465 CAGGGGAAGAGTGAAGAGGAAGG + Intronic
1018567562 6:165171012-165171034 GAGGAGGAGAAGGAAGGGGAGGG + Intergenic
1018611130 6:165648938-165648960 GATGGGGACAAGGATGGGGATGG - Intronic
1018738989 6:166713066-166713088 CTTGGGAAGAAGCATGGGGAAGG - Intronic
1018743391 6:166746952-166746974 CATGGGGTGAAGCATGGGGAAGG + Intronic
1018948436 6:168363331-168363353 GAGAGGAAGATGGAGGGGGAGGG + Intergenic
1018960991 6:168448429-168448451 GATGGGGAGAAGGATGAGGATGG + Intronic
1019196175 6:170284414-170284436 CAGGGGAGGGAGGGAGGGGAAGG + Intronic
1019334968 7:478659-478681 GAAGGGAAGGAGGAAGGGGAGGG + Intergenic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019428116 7:986853-986875 CAGGGGAGCACGGCTGGGGAGGG + Intronic
1019479882 7:1261497-1261519 CAGGGGAGGATGGCAGGGGACGG + Intergenic
1019508355 7:1404804-1404826 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508370 7:1404838-1404860 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508385 7:1404872-1404894 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019508400 7:1404906-1404928 GAGGGGAGGGAGGAGGGGGAAGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019531670 7:1506530-1506552 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1019551828 7:1606909-1606931 GAGGGGTAGGAGGAGGGGGAGGG - Intergenic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020143535 7:5625264-5625286 GCTGGGGAGAAGGATGGGGAGGG + Intronic
1020466118 7:8481819-8481841 CAGGGGAGGAAGGAGGGAGTGGG - Intronic
1021000908 7:15329037-15329059 CAGGGGAGGAAGGATAGTGAAGG - Intronic
1021128263 7:16880067-16880089 AGGGGAAAGAAGGAAGGGGAAGG - Intronic
1021365201 7:19770164-19770186 AAGGGGGAGAAAGATTGGGATGG - Intronic
1021440734 7:20671465-20671487 CAGGGGAGGAGGGCTGGAGAGGG - Intronic
1021970513 7:25961133-25961155 GATGGGAAGAAGGCAGGGGAGGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022103377 7:27182344-27182366 CAGGGGCAGGAGGAAGGGGTAGG - Exonic
1022593300 7:31687113-31687135 CAGGGCAAGGGGGATGGAGAAGG - Exonic
1023003735 7:35840173-35840195 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
1023057206 7:36299971-36299993 CAGGGGATGAAGGAGGGGCTGGG - Exonic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1023160401 7:37291926-37291948 CAGAGGGAGAGGGAGGGGGAGGG - Intronic
1023362288 7:39429339-39429361 CCGAGGAAGAAAGGTGGGGATGG - Intronic
1023370974 7:39511989-39512011 CTGGTGAAGAAGGTTGGGGTGGG - Intergenic
1023467115 7:40468441-40468463 TAGGGGCAGAAAGATGGGGTAGG - Intronic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1023565691 7:41521943-41521965 CAAGGGAAGAAAGAAGGGAAGGG + Intergenic
1023816655 7:43955751-43955773 CAGGGGAAGAAGGGGTGGGGAGG - Exonic
1023827378 7:44018715-44018737 GAGGGGATGAAGGATGGAGGTGG + Intergenic
1023860362 7:44214652-44214674 CAGCGGGATCAGGATGGGGATGG - Intergenic
1024196465 7:47064036-47064058 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1024385680 7:48748795-48748817 CAGGCGAAGCAGCATGGGGGAGG + Intergenic
1024744297 7:52389053-52389075 CCGGGGAAGAGGTATGTGGATGG + Intergenic
1024970203 7:55062136-55062158 CAAGGCTAGAAAGATGGGGAAGG + Intronic
1025271389 7:57522234-57522256 GAGGGGTGGAAGGAAGGGGAGGG - Intergenic
1025769921 7:64495073-64495095 CAGGGGAAGGAGGAGGGGCGGGG - Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025929322 7:65981886-65981908 CAGGGGAAGAAGTCTGCGGGGGG + Intronic
1026000754 7:66557860-66557882 CAGGGGCAGATGGAGGGGGTGGG + Intergenic
1026040695 7:66865777-66865799 GAGGGGCAAAAGGAAGGGGAAGG - Intergenic
1026085900 7:67262829-67262851 CAGGGTCAGAGGGTTGGGGAGGG + Intergenic
1026104160 7:67407877-67407899 GAGGGGAGGAGGGATGAGGAAGG - Intergenic
1026167295 7:67921819-67921841 CAGGGGAGGCAGGATGGCAATGG + Intergenic
1026238023 7:68545754-68545776 GAGGGAGAGAAGGAGGGGGAGGG - Intergenic
1026285045 7:68955407-68955429 AAGGGGAAGAGGCAGGGGGATGG + Intergenic
1026691266 7:72552049-72552071 CAGGGTCAGATGGTTGGGGAGGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026984204 7:74544840-74544862 CAGGGGAAGAGAGATGGGGTGGG - Intronic
1027050551 7:75018881-75018903 CCTGGGAAGAGGGCTGGGGAGGG - Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027159772 7:75793791-75793813 AAGGGGAGGAAGGAAGGGGAAGG + Intergenic
1027208498 7:76123887-76123909 CTGTGGAAGAAGCATGGAGACGG - Intergenic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027464918 7:78503560-78503582 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
1027753805 7:82185477-82185499 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1027766136 7:82344627-82344649 CAGGGGGAGGATGATGGTGAAGG + Intronic
1027832604 7:83199140-83199162 CAGTGGAAGAAGGAGGGGCAAGG + Intergenic
1028052772 7:86206771-86206793 GAGGGGAAGAAGGGAAGGGAAGG + Intergenic
1028617955 7:92791175-92791197 CGGGGGTGGAGGGATGGGGAAGG + Intronic
1028835105 7:95366026-95366048 CAGGGGGAGTGGGGTGGGGAGGG + Intronic
1029187257 7:98748150-98748172 GAGGGAAAGAAGGAAGGAGAGGG + Intergenic
1029272451 7:99385291-99385313 CAGGGGAAGTTGGGTGGGGGGGG + Intronic
1029382497 7:100222789-100222811 CCTGGGAAGAGGGCTGGGGAGGG + Intronic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029412873 7:100426927-100426949 AAGGGGAGGGAGGAGGGGGAGGG - Intronic
1029611612 7:101629649-101629671 CAGGGGAATTTGGCTGGGGATGG - Intergenic
1029612789 7:101636297-101636319 AAGGGAAGGAAGGAAGGGGAAGG + Intergenic
1029677453 7:102080149-102080171 CGGGGGAGGATGGATGGAGAAGG - Intronic
1029738534 7:102478462-102478484 GAGGGGATGAAGGATGGAGGTGG + Intronic
1029755664 7:102572125-102572147 GAGGGGATGAAGGATGGAGGTGG + Intronic
1029773613 7:102671205-102671227 GAGGGGATGAAGGATGGAGGTGG + Intronic
1029903612 7:104068308-104068330 CAGGGTAGGAAGAATGGAGAGGG + Intergenic
1029927781 7:104335935-104335957 CAGGAGATGAACTATGGGGAGGG + Intronic
1030028431 7:105347529-105347551 CAGCCGAAGAATGAGGGGGAGGG + Intronic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030365536 7:108641588-108641610 CAGGGAAGGAAGGAAGGAGAGGG - Intergenic
1030380259 7:108803248-108803270 TAAGGGAAGAAAGAAGGGGAAGG - Intergenic
1030503272 7:110386548-110386570 CAGGGGAAATAGGATGGAGAGGG + Intergenic
1031595080 7:123640672-123640694 GAGGGGGAGGAGGAGGGGGAGGG + Intergenic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1031941836 7:127797600-127797622 CAGGGAAAGGAAGATGGGGCAGG + Intronic
1031989821 7:128190175-128190197 GAGGGGAAGCAGGATTGGGCAGG + Intergenic
1032220124 7:129988156-129988178 GAGGCGAGGAAGGATGGGGAAGG + Intergenic
1032262331 7:130347451-130347473 CAGGGGAAGAAGGAAGGGAAAGG - Intronic
1032345306 7:131110714-131110736 TTGGGGAAGGAGGATGGTGAGGG - Intronic
1032429541 7:131849623-131849645 CAAGTGAAGAAGGGTGTGGAGGG - Intergenic
1032441354 7:131945254-131945276 GAGAGGACAAAGGATGGGGAAGG + Intergenic
1032515033 7:132500461-132500483 GAGAAGAAGAAGGAGGGGGAGGG + Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033045967 7:137962444-137962466 AAGGGGAAGGAGGATGGTGCGGG - Intronic
1033116797 7:138632621-138632643 CAGAGGAAGTAGGATGTGGAGGG + Intronic
1033124796 7:138698158-138698180 GAGGGAAAGAAGGAGGGGGAAGG + Intronic
1033301478 7:140189976-140189998 CAGGGGCAGATGCATGGAGAAGG + Intergenic
1033354891 7:140591833-140591855 GAAGGAAAGAAGGAAGGGGAGGG - Intronic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1033804362 7:144937525-144937547 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804369 7:144937538-144937560 AAGGGGAAGGGGGAAGGGGAAGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1033959413 7:146895258-146895280 GAAGGAAAGAAGGAAGGGGAAGG - Intronic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1034014378 7:147566323-147566345 GAGGGGTAGAGGGAGGGGGAGGG + Intronic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034271145 7:149803916-149803938 CAGGGGATGAAGGATGAAGAAGG + Intergenic
1034944934 7:155255677-155255699 AAGGGGGAGAGGGAGGGGGAGGG + Intergenic
1035009883 7:155705603-155705625 CTGGGGAAGAAGGCAGGAGAAGG + Intronic
1035084755 7:156248539-156248561 CATGGGAAGCAGGGTGGTGAGGG - Intergenic
1035226726 7:157438017-157438039 GAGGAGGGGAAGGATGGGGAGGG - Intergenic
1035226746 7:157438076-157438098 GAGGAGGGGAAGGATGGGGAGGG - Intergenic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1036256123 8:7208131-7208153 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036361361 8:8079368-8079390 CAGGTGAAGAAGCAGGGAGAGGG - Intergenic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036576570 8:10032983-10033005 AAGGGAAGGAAGGAAGGGGAGGG - Intergenic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1036665402 8:10734083-10734105 GAGGGGGAGAAGGAGGGGGAGGG + Intronic
1036748655 8:11429121-11429143 CAGGGGCTGGAGGAGGGGGATGG - Intronic
1036889613 8:12587655-12587677 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037569686 8:20147889-20147911 CAGAGGCAGAAGGATCAGGAGGG - Intronic
1037611545 8:20480396-20480418 AAAGGGAAGGAGGATGGGGGTGG + Intergenic
1037674127 8:21039690-21039712 AAGGGAAAGATGGATGGGGATGG - Intergenic
1037738148 8:21583038-21583060 CAGGGCTAGAAAGAAGGGGAGGG + Intergenic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1038033031 8:23661445-23661467 CAGAGGGCAAAGGATGGGGAAGG + Intergenic
1038387695 8:27164811-27164833 GGGGGGAAAAAAGATGGGGATGG + Intergenic
1038542570 8:28402094-28402116 CGGGGGAAGAGGGTTGGGGCTGG - Intronic
1038610288 8:29054555-29054577 CAGTGGATGAAGGCTGGGGAGGG + Intronic
1039094577 8:33869700-33869722 CAGGTGAAGAAGGCTTGGAAGGG - Intergenic
1039129154 8:34241991-34242013 GAGAGGAAGAAAGTTGGGGAAGG + Intergenic
1039435988 8:37559566-37559588 GAGGAAAAGAAGGAGGGGGAGGG + Intergenic
1039500040 8:38009396-38009418 CAAGGGAAGAATCATGGGAAAGG + Intergenic
1039529901 8:38251414-38251436 CAAGGGAAGTAGGATGTCGATGG - Intronic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1039611721 8:38924428-38924450 CTGGGGAAGGAGGACAGGGAAGG + Intronic
1039614801 8:38946805-38946827 AAGGGTAGGAAGGATGGAGAGGG + Intronic
1039691304 8:39867669-39867691 GAGAAGAAGAAGGAGGGGGAAGG - Intergenic
1039913702 8:41844421-41844443 CAGGCGATGGAGGTTGGGGAGGG - Intronic
1039965380 8:42280253-42280275 CAGGGGAAGCAGGTTGTGGTGGG - Intronic
1040013680 8:42682973-42682995 CAGGGGAAGAGAGAAGGGGAAGG + Intergenic
1040279580 8:46032171-46032193 CAGGGGAAGAAGCACTGTGACGG + Intergenic
1040454680 8:47584869-47584891 CAGGGGCAGATGGAGTGGGAGGG - Intronic
1040835854 8:51731001-51731023 CAGGGGCAGAATGATGTGGTTGG - Intronic
1041252256 8:55945936-55945958 CAGCGGCAGCAGGATGGAGACGG - Intronic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041820296 8:62024421-62024443 CAGGGGATGAAGGATAGCAATGG - Intergenic
1041924398 8:63221581-63221603 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1042487653 8:69364010-69364032 GAGGAGGAGAAGGAAGGGGAGGG + Intergenic
1042841831 8:73131785-73131807 AAGGGGAAGAAGGGGGGGGAAGG - Intergenic
1042843228 8:73145882-73145904 CACGGGAAGAAAGATGGAAAAGG - Intergenic
1042863111 8:73333404-73333426 AAAGGGAAGAAGCATGGGAAAGG + Intergenic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1043358342 8:79440278-79440300 CTGGGGAAGTAGGAAGGGGGTGG + Intergenic
1043979820 8:86624741-86624763 CAGGTTAAGAAGGATGAGGGTGG - Intronic
1044168450 8:89018636-89018658 GAAGGGAAGAAGGAAGGGGAAGG - Intergenic
1044169696 8:89034194-89034216 GAGGGGAGGAAGGAGGAGGAGGG + Intergenic
1044805705 8:96006042-96006064 GAGGGGATGAAGGATGGGTGAGG + Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1044933813 8:97275365-97275387 TAAGGAAAGAAGGAAGGGGAAGG + Exonic
1045379508 8:101609203-101609225 CAGGGAAGGAAGGAAGGGGAAGG + Intronic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046731155 8:117727795-117727817 CAAGGGAAAAAGGATGAGGGAGG - Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046846171 8:118919135-118919157 CAAGAAAATAAGGATGGGGAGGG + Intergenic
1046871887 8:119213075-119213097 CAATGAAAGAAGGATGGAGAAGG + Intronic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1047065674 8:121279589-121279611 GAGTGGCAGAATGATGGGGAGGG + Intergenic
1047187274 8:122645509-122645531 GAGGGCAAGAGAGATGGGGAAGG - Intergenic
1047201766 8:122773190-122773212 AAGGGGTATAAGGATGTGGATGG + Intergenic
1047343631 8:124006243-124006265 CAGGGGAAGATGGTAAGGGAAGG + Intronic
1047345101 8:124020202-124020224 CATGGGGAGAATCATGGGGAAGG - Intronic
1047432552 8:124805412-124805434 CAGAGGAAGCAGGAGAGGGAAGG + Intergenic
1047718782 8:127619792-127619814 AAGGGGAGGAAGGAGAGGGAAGG - Intergenic
1047815732 8:128460317-128460339 CAAGGGAAGCAGGATAGGGCAGG + Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1047884239 8:129230938-129230960 CAGGGGAAGAGGCATGTAGATGG + Intergenic
1048010749 8:130453744-130453766 CAGGGGAATGAGGAAGGGAAAGG + Intergenic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048214603 8:132482430-132482452 GAAGGGAAGAAGGAAGGGAAGGG + Intergenic
1048447713 8:134504438-134504460 CAGGGAAAGAAGAAAGGGCACGG + Intronic
1048517449 8:135123800-135123822 CAGGAGAAGAAGGAAAGGGAAGG - Intergenic
1049202060 8:141345134-141345156 CAGGGGAAGAGGGAAGTGAATGG + Intergenic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049595333 8:143480828-143480850 CATGGCAGGAAGGCTGGGGAAGG + Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1049895694 9:109296-109318 CAGGTAAGGAAGGGTGGGGACGG - Intergenic
1049923917 9:390702-390724 TAGTGGAAGAAGGATGGGAGGGG - Intronic
1050041488 9:1499463-1499485 CAGGGGTGGGAAGATGGGGAAGG - Intergenic
1050094169 9:2047060-2047082 GAGGGCAAGAAGGAAGAGGAGGG - Intronic
1050357758 9:4799052-4799074 GAGGGGGAGAGGGATGGGGGAGG - Intronic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050495273 9:6234415-6234437 GAGGGGAAGCAGGGTGGTGAAGG - Intronic
1050575792 9:6994027-6994049 CAGGGGTATAGGGGTGGGGATGG + Intronic
1050672570 9:8014377-8014399 AAGGGGATGAAAGATGGAGATGG + Intergenic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1050707200 9:8414887-8414909 GAGGGAGAGAGGGATGGGGAGGG + Intronic
1050969089 9:11846329-11846351 GAGGGAAAGAAAGATGGGGAAGG - Intergenic
1051366355 9:16324150-16324172 CTGAGGAAAAAGGAAGGGGAGGG + Intergenic
1051501792 9:17786082-17786104 CAGTGAAGGGAGGATGGGGAAGG + Intronic
1051606712 9:18923906-18923928 CAGTGGTTGGAGGATGGGGAAGG - Intergenic
1051659423 9:19411524-19411546 CAGGGGAAGAAGGCCGGGCATGG - Intronic
1052370865 9:27663173-27663195 AAGGGAAAGGAGGATGGGGGAGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052528310 9:29650268-29650290 CAAGGGAAGAATCATGGGAAAGG - Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1052864554 9:33457092-33457114 CAGGGGAAGAATCCAGGGGAGGG + Intergenic
1052918204 9:33940000-33940022 GAGGGGAAAGAGGAGGGGGAGGG + Intronic
1052923496 9:33992587-33992609 GAGGGGCAGTAGGATGGGGAGGG - Intronic
1052951812 9:34219726-34219748 GAGGGGAAGGGGGAGGGGGAGGG - Intronic
1053233819 9:36434323-36434345 TGGGGGAAGGAGGAGGGGGAGGG + Intronic
1053430331 9:38038126-38038148 CATGGGGCGTAGGATGGGGAGGG - Intronic
1053472233 9:38355123-38355145 GAGAGGAAGAAGGAAGGGGAGGG + Intergenic
1053499563 9:38574061-38574083 CTGGGAAATAAGAATGGGGAGGG - Intronic
1053799903 9:41757668-41757690 GATGGGTAGATGGATGGGGATGG + Intergenic
1054145281 9:61557163-61557185 GATGGGTAGATGGATGGGGATGG - Intergenic
1054188335 9:61969816-61969838 GATGGGTAGATGGATGGGGATGG + Intergenic
1054451213 9:65404429-65404451 CAGGGGAAGAAGCTGGGGCAGGG - Intergenic
1054464964 9:65488020-65488042 GATGGGTAGATGGATGGGGATGG - Intergenic
1054650190 9:67618805-67618827 GATGGGTAGATGGATGGGGATGG - Intergenic
1054735636 9:68747066-68747088 CAGGGAAAGAATGAGAGGGAAGG - Intronic
1054909456 9:70440768-70440790 AAGGGGAGGAAGGAAAGGGAAGG + Intergenic
1055036380 9:71822861-71822883 CAGAGAAAGAAGGAAGGGAAGGG - Intergenic
1055141528 9:72882223-72882245 CAGATAAAGAAGGATTGGGATGG + Intergenic
1055371227 9:75601764-75601786 CAGGGAGAGAGGAATGGGGAAGG + Intergenic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055581465 9:77711106-77711128 GAGGGGGAGAAGGAAGGGGAGGG - Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055748518 9:79477823-79477845 TTGGGGAAGATGGTTGGGGAGGG - Intergenic
1056040065 9:82656138-82656160 GAAGGGAAGAAGGAAGGGGAAGG + Intergenic
1056108536 9:83371836-83371858 CAAGGGAAGGAGGAATGGGAAGG + Intronic
1056244483 9:84680665-84680687 CAGGAGCAGAAGGAGAGGGAGGG - Intronic
1056269250 9:84930524-84930546 CAGGGGATGAGGGATAGAGATGG + Intronic
1056320622 9:85431382-85431404 CAGGGAAGGAAGGAGAGGGATGG - Intergenic
1056395819 9:86180277-86180299 CAGGGAAAGCAAGATGGGGAAGG - Intergenic
1056540215 9:87564562-87564584 GAAGGCAAGAGGGATGGGGAGGG + Intronic
1056765577 9:89442787-89442809 AATGGTGAGAAGGATGGGGAGGG - Intronic
1056814617 9:89792264-89792286 CAGGGGTAGGAGGATTTGGATGG + Intergenic
1056949033 9:91027163-91027185 GACGGGAAGAAGCATGGGGTCGG + Intergenic
1057076102 9:92138977-92138999 CAGGTAGAGAAGGCTGGGGATGG - Intergenic
1057191847 9:93092772-93092794 CATGGGGACAAGGATGGGGCAGG + Intergenic
1057389066 9:94627936-94627958 CAGGGGAGGGAGGTAGGGGAAGG - Intronic
1057394251 9:94665586-94665608 CATGGTAAGAAGGAGGGAGATGG + Intergenic
1057430194 9:94987068-94987090 CATGGGAAGAAGGATAGGAAAGG - Intronic
1057453080 9:95182885-95182907 CAGGGGAAGGTGACTGGGGAAGG + Intronic
1057489674 9:95511224-95511246 CCGGGGAGGAAGGAAGGGGGCGG - Intronic
1057559170 9:96113954-96113976 CAGGGGAAGCTGGCTGGGAAGGG - Intronic
1057739364 9:97698388-97698410 GAGGGGAAGGGAGATGGGGATGG - Intergenic
1057852036 9:98573186-98573208 CAGGAGATGAAGGAAGGGGTGGG + Intronic
1057972053 9:99567836-99567858 AAGGGGAAGAAGGCTGGGCACGG + Intergenic
1058040183 9:100294211-100294233 GAGAGGAAGACGGATGGGGAGGG + Intronic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058139462 9:101342426-101342448 GAGGGGAAGAGGGAAGGGGAGGG + Intergenic
1058324647 9:103680294-103680316 GAAGGGAAGAAGGAAAGGGAAGG + Intergenic
1058375292 9:104316052-104316074 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1058469998 9:105268013-105268035 CAGGGAAAGAAGGTTGGGGTGGG + Intronic
1059306260 9:113355504-113355526 GAGGGGAAGAGGGCAGGGGAGGG - Intronic
1059382446 9:113936976-113936998 GAGGGGAATGAGGTTGGGGAAGG - Intronic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1060148249 9:121269573-121269595 CAGAGGAGGAAGGATGGGGGTGG + Intronic
1060207802 9:121692861-121692883 CCGGGGAACAGGGAAGGGGAGGG + Intronic
1060232892 9:121838885-121838907 CAGGGCAAGAAAGGTGGGCAGGG - Intronic
1060238545 9:121884140-121884162 GAGGGGGAGGTGGATGGGGACGG - Intronic
1060283520 9:122228973-122228995 GAGGAGAAGAAGGAGGGGGCGGG - Intronic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1060723300 9:125992279-125992301 CGGGGGGAGAAGGAAGGGGATGG - Intergenic
1060765351 9:126291650-126291672 GTGGGGAAGAAGGATCAGGAGGG - Intergenic
1060805681 9:126574691-126574713 CTGGGGAACATGTATGGGGATGG - Intergenic
1060923395 9:127438389-127438411 CATGGGACGAGGGGTGGGGAAGG + Intronic
1060977002 9:127770754-127770776 CAGGGGAAGAAGGCTTGGGCTGG + Intronic
1061086898 9:128404788-128404810 AAGGGGAGGAGGGATGGGGGAGG + Intergenic
1061281828 9:129602016-129602038 CTGCCCAAGAAGGATGGGGAGGG - Intergenic
1061331881 9:129899787-129899809 AAGGGAAGGAAGGAAGGGGAAGG + Intronic
1061899691 9:133666542-133666564 AAGGAGGAGAAGGAGGGGGAAGG - Intronic
1061912974 9:133734703-133734725 CCGGGCAGGGAGGATGGGGAGGG + Intronic
1061917098 9:133760946-133760968 CTGAGGACGAAGGATCGGGAAGG + Intergenic
1062074745 9:134579787-134579809 GAGGGGGAGAAGGAGCGGGAGGG + Intergenic
1062074780 9:134579872-134579894 GAGGGGGAGAAGGAGCGGGAGGG + Intergenic
1062085500 9:134645995-134646017 AAGGGAAGGAAGGAAGGGGATGG - Intronic
1062091473 9:134680766-134680788 CAGGGGCAGAAGGACGGGTGAGG + Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062143715 9:134976690-134976712 GAGGGGAAGGGGGAGGGGGAGGG - Intergenic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062254244 9:135613643-135613665 CAGGGGCAGGAGGATGGGGCAGG + Intergenic
1062326115 9:136013322-136013344 CAGGGTGAGGATGATGGGGAGGG + Intronic
1062463220 9:136670451-136670473 CCAGGGAGGGAGGATGGGGAGGG + Intronic
1062469617 9:136696842-136696864 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469627 9:136696860-136696882 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469659 9:136696922-136696944 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469682 9:136696967-136696989 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469692 9:136696985-136697007 GAGGGGAGGGAGGAGGGGGAGGG - Intergenic
1062469733 9:136697064-136697086 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062513257 9:136919654-136919676 GAGGGAAAGAAGGAGGGGGAGGG - Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1203707283 Un_KI270742v1:63976-63998 CTGGGAAATAAGAATGGGGAGGG + Intergenic
1185511493 X:667935-667957 GAGGGGAAGAGGGGAGGGGAGGG - Intergenic
1185512001 X:670725-670747 CAGAGGAAGAAAGACGGGGCTGG + Intergenic
1185596921 X:1312850-1312872 CAGGGGTAGAAGGTTCCGGAAGG - Intergenic
1185729708 X:2451540-2451562 TAGGGGAAGAAGAATGTGGACGG + Intronic
1185757441 X:2662901-2662923 TAGGGGAAGAATCATGGGAAAGG + Intergenic
1186045571 X:5532888-5532910 CAGAGGAAGAAGGAGGGAGGGGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186701583 X:12095897-12095919 CACAGGAAGCAGGATGGAGAGGG - Intergenic
1186899998 X:14043836-14043858 CAGGGGAGAAAGGAAGGAGAGGG + Intergenic
1187345123 X:18456782-18456804 CAGAGGAAGAAGGCTAGAGATGG - Intronic
1187561209 X:20405451-20405473 CACGAGAAGAAGGTTGGGGAGGG - Intergenic
1187636880 X:21238711-21238733 AAGGGGAAGGAGGAGTGGGAAGG + Intergenic
1187864934 X:23715371-23715393 CTGGGGAATAGGGATGGGGGAGG - Intronic
1188505989 X:30885582-30885604 CTGGGAAAGAAGGATGGAGCGGG + Intronic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1189013401 X:37070645-37070667 AAGGGGAAGAAAGTTTGGGAAGG - Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189093654 X:38114266-38114288 CAGATGAAGATGGATTGGGAAGG - Intronic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189296399 X:39921353-39921375 AAGGGGAGGAACGATGGGGGCGG - Intergenic
1189341513 X:40207951-40207973 CTGGGGAAGAAGGAGGGGGGTGG + Intergenic
1189383800 X:40520569-40520591 CAAGGGCAGAAGGCAGGGGATGG + Intergenic
1189419414 X:40843438-40843460 AAAGGGAAGAAGGGTGGGGCAGG - Intergenic
1189514942 X:41704028-41704050 TAGGGGAAAAGGGAGGGGGAGGG - Intronic
1189891797 X:45610565-45610587 CAGGGGAAGGAGGGTGTGGGTGG + Intergenic
1190053499 X:47169288-47169310 TGGAGGAAGAAGGATGGGGAGGG - Intronic
1190203113 X:48381215-48381237 AAAGGGAAGAAGGAAGGGAAGGG - Intergenic
1190207425 X:48414194-48414216 AAAGGGAAGAAGGAAGGGAAGGG + Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190469505 X:50764218-50764240 CAGGAGCTGGAGGATGGGGATGG + Intronic
1190477219 X:50840128-50840150 CTGGGCAGGAAGGCTGGGGAGGG - Intergenic
1190720006 X:53139862-53139884 AAGGGGGAGGAGGAAGGGGAAGG + Intergenic
1191006213 X:55714082-55714104 GAGGGGTAGAAGGAAGGGAATGG - Intergenic
1191091774 X:56631115-56631137 CATTGGAAGATTGATGGGGATGG + Intergenic
1191896460 X:65998337-65998359 AAAGGAAAGTAGGATGGGGAGGG - Intergenic
1192185052 X:68941000-68941022 GAGGGGAGGAAGGGTGAGGAGGG + Intergenic
1192195975 X:69028480-69028502 TAGGGCAAGAAGGATGGGAAAGG - Intergenic
1192288066 X:69759806-69759828 CTGGGGAATAAGGATAAGGAAGG + Intronic
1192418357 X:71005082-71005104 AAGAGGAAGAGGGATGGGGATGG - Intergenic
1192448960 X:71230903-71230925 AAGGGGAAGGAAGAGGGGGAAGG + Intergenic
1192576255 X:72245600-72245622 CAGGGGAAGCAGGAAGGAGGAGG + Intronic
1192900779 X:75493930-75493952 CAGGGCAATAAGGCAGGGGAAGG + Intronic
1192925415 X:75750211-75750233 ATGGGGATGGAGGATGGGGAGGG - Intergenic
1193085823 X:77447411-77447433 CCGGGGGAGATGGATGCGGAGGG + Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1193415407 X:81216569-81216591 TAGGGTAGGGAGGATGGGGATGG - Intronic
1193815790 X:86102930-86102952 AAGGGGAAGAAAGAGTGGGAAGG + Intergenic
1194411279 X:93561736-93561758 AAGAGGAAGAAGGACAGGGAAGG - Intergenic
1194443624 X:93961731-93961753 TTGGGGAAGAAATATGGGGATGG + Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1194636143 X:96346907-96346929 CAGGGGTAGCTTGATGGGGACGG + Intergenic
1194648085 X:96482790-96482812 TAAGGGAAGAAGCATGGGAAAGG - Intergenic
1194737610 X:97531232-97531254 GACTGGAAGAAGGAAGGGGAAGG - Intronic
1195655532 X:107328212-107328234 CAGGGCAGGAAGCATGGGCAAGG + Intergenic
1195676892 X:107513421-107513443 AAGGGGCAGGAGGATGGGCAGGG - Intergenic
1195971073 X:110474129-110474151 TGGGGGAGGAAGGATGGGGGTGG - Intergenic
1196117571 X:112014082-112014104 CAGTAGAAGTGGGATGGGGATGG + Intronic
1196198404 X:112858885-112858907 CAAGGGAAGGGGAATGGGGAAGG - Intergenic
1196522919 X:116695232-116695254 CATGTGAATAAGGATGGGAATGG - Intergenic
1197097498 X:122613037-122613059 TTGGGGAAGAAGTATGCGGATGG + Intergenic
1197116020 X:122834906-122834928 GAGGGGAAGAGAGAGGGGGAGGG - Intergenic
1197116034 X:122834941-122834963 GAGGGGAAGAGAGAGGGGGAGGG - Intergenic
1197581695 X:128291924-128291946 TAGGGGGAGAGGGGTGGGGATGG + Intergenic
1197597662 X:128485887-128485909 CAGAGGAATTAAGATGGGGAAGG - Intergenic
1197703438 X:129616837-129616859 AAGGAGAAGAAGGATTGGGATGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1197774800 X:130111713-130111735 CAGGGGAAGAAAGGTAGGCATGG - Intergenic
1197798381 X:130322418-130322440 CAGGGGAAAGAGGAAGGGGTTGG - Intergenic
1198015939 X:132610970-132610992 CAGGGGAAGAAAGAAGAGGAGGG + Intergenic
1198509958 X:137340597-137340619 GAGGGGAAGAGGGATAGTGAAGG + Intergenic
1198510096 X:137341756-137341778 GAGGGGAAGAGGGATAGTGAAGG - Intergenic
1198691718 X:139292104-139292126 CAGGGGAAGAGGGAATGGAAAGG + Intergenic
1199023049 X:142904739-142904761 TAGGGGTAGGAGGCTGGGGATGG + Intergenic
1199538712 X:148933268-148933290 AAGGGTAAGAATGTTGGGGAAGG + Intronic
1199731469 X:150637308-150637330 CAGAGGAAAATGGTTGGGGAGGG + Intronic
1200253103 X:154564271-154564293 AAGGGGAGGATGGAGGGGGACGG - Intronic
1200264664 X:154640144-154640166 AAGGGGAGGATGGAGGGGGACGG + Intergenic
1200745969 Y:6904244-6904266 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1200751136 Y:6945243-6945265 AAAGGGAAGAAGAATGGGAAAGG - Intronic
1200788052 Y:7275851-7275873 GCGGGGAAGAAGGGTGGGGCAGG + Intergenic
1201752776 Y:17451468-17451490 CAGGGGAGAAAGGGTGGGAAGGG + Intergenic
1202173842 Y:22079554-22079576 TAGGGGAAGAATCATGGGAAAGG - Intronic
1202217518 Y:22506828-22506850 TAGGGGAAGAATCATGGGAAAGG + Intronic
1202325667 Y:23689231-23689253 TAGGGGAAGAATCATGGGAAAGG - Intergenic
1202545104 Y:25980823-25980845 TAGGGGAAGAATCATGGGAAAGG + Intergenic