ID: 904015766

View in Genome Browser
Species Human (GRCh38)
Location 1:27419403-27419425
Sequence ATTTCTACACATTTCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 6, 3: 9, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904015765_904015766 -5 Left 904015765 1:27419385-27419407 CCTGGAAGAAAAGATAATATTTC 0: 1
1: 1
2: 4
3: 58
4: 523
Right 904015766 1:27419403-27419425 ATTTCTACACATTTCCAGCCTGG 0: 1
1: 0
2: 6
3: 9
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904015766 Original CRISPR ATTTCTACACATTTCCAGCC TGG Intronic
904015766 1:27419403-27419425 ATTTCTACACATTTCCAGCCTGG + Intronic
904307242 1:29598094-29598116 GTTTCTCCCCATTTCCTGCCTGG - Intergenic
907840441 1:58152032-58152054 ATTTTTACTCATTTTCACCCTGG - Intronic
909300670 1:74009432-74009454 ATTTTTTCTCATTTCCAGCTTGG + Intergenic
911156044 1:94637816-94637838 ATTTCCACAGGTTTCCAGCAAGG + Intergenic
911955393 1:104227735-104227757 ATTTCTGCCCATTTGAAGCCAGG + Intergenic
915622166 1:157092542-157092564 ATTTCAGCCCATGTCCAGCCAGG + Exonic
916434393 1:164763730-164763752 AATTGTACACATTTGCAGCAAGG + Intronic
918723394 1:187884500-187884522 ATTTATTCATATTTTCAGCCTGG + Intergenic
919024759 1:192152745-192152767 ATTTCTACTCATTGGCAGCTGGG + Intergenic
921503546 1:215937795-215937817 AATTTTACAAATTTTCAGCCAGG + Intronic
922516881 1:226214535-226214557 AATTCTCCACATTGCCGGCCGGG - Intergenic
922537333 1:226390862-226390884 AATTCTTCACATGTCCAGGCAGG - Intronic
922672105 1:227518220-227518242 AATTCTACAAATTTCCTACCAGG - Intergenic
922806054 1:228390288-228390310 ATTTCTCCATATTGCCAGGCTGG - Intergenic
922961542 1:229650894-229650916 GTTTCTACCCATTTCCAGAATGG + Intronic
924711921 1:246536422-246536444 ATTTCTTCACATTTATATCCAGG - Intergenic
1065690840 10:28331965-28331987 ATTTCTAAACATCTGCAACCTGG - Intronic
1066784259 10:38985391-38985413 ATCTCTAAACATCTCCACCCAGG - Intergenic
1067562032 10:47310848-47310870 ATGTCTACCTATTTCCTGCCTGG - Intronic
1069612763 10:69786185-69786207 ATTTCTGAACATCTTCAGCCAGG - Intergenic
1069989420 10:72305735-72305757 ATGTCTAAACATTTCTTGCCAGG - Intergenic
1074492327 10:113949488-113949510 ATGCCTAAACATTTCCAACCAGG - Intergenic
1075227705 10:120644640-120644662 CTTTCTACTCCTTTCCAGACAGG - Intergenic
1075281980 10:121147069-121147091 ATTGCAACACTTTTCCAGCAAGG - Intergenic
1080943826 11:36949043-36949065 ATTTTTAAACATTTCTACCCGGG - Intergenic
1082989732 11:59197059-59197081 ATTTCTTCACCTGCCCAGCCAGG + Intronic
1084479001 11:69406898-69406920 ATTTATACACATTTCAAGATTGG + Intergenic
1086414371 11:86574245-86574267 ATCTCAACACATCTCCAGCAAGG - Intronic
1086800597 11:91170060-91170082 ATTGCTACACTTCTCCAGCAAGG + Intergenic
1086837053 11:91637873-91637895 ATTTCTACATATTTTGAGGCAGG + Intergenic
1088008442 11:104970031-104970053 ATTTCAACACTTCTCCAGCAAGG + Intergenic
1088020517 11:105112565-105112587 ATTTCAACACTTCTCCAGCAAGG + Intergenic
1088381788 11:109201156-109201178 ATTTCTTCACACTTCAAGCCTGG - Intergenic
1088402500 11:109436602-109436624 ATTTCTACACACTTTCATTCGGG + Intergenic
1090055354 11:123418752-123418774 ATTTCTAGAGACTTCCAGGCTGG + Intergenic
1090267950 11:125365764-125365786 ATCTCTCCACATTTTCTGCCAGG + Intronic
1090449702 11:126795677-126795699 ATTTCTACATATTTCTGGCCAGG - Intronic
1091396628 12:157341-157363 AATGCCCCACATTTCCAGCCTGG - Intronic
1094279812 12:28723721-28723743 ATTTCAAGACCTTTGCAGCCAGG + Intergenic
1094492833 12:30971813-30971835 ATTTCTGCATATTTCCTGCAAGG + Intronic
1097090892 12:56503830-56503852 ATTTCCAAAAAGTTCCAGCCGGG - Intergenic
1098764419 12:74468553-74468575 ATTGCAACACATCTCCAGCAAGG - Intergenic
1099872468 12:88367416-88367438 GTTTCCAAACATTTGCAGCCAGG - Intergenic
1101224371 12:102673148-102673170 AGTTCTACACAGTTCAAACCTGG + Intergenic
1101599437 12:106196231-106196253 TTTTTTACACATTTCTAGTCTGG - Intergenic
1102818163 12:115885697-115885719 ATTTCCTCTCATTTCCTGCCTGG + Intergenic
1103893494 12:124257131-124257153 ATAGCTACAGTTTTCCAGCCTGG - Intronic
1104058282 12:125246875-125246897 ATTTCATCACATTTCCCACCGGG + Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105470079 13:20685535-20685557 ATTTCCAAACATTCCCAGCAGGG - Intronic
1106688944 13:32092793-32092815 ATTTCTCCCCATTTGCAGACTGG - Intronic
1106868132 13:33989468-33989490 CTTTCTACATATGGCCAGCCAGG - Intergenic
1107287442 13:38811008-38811030 ATTTCTACACAGTTCAATCTTGG + Intronic
1107586529 13:41855156-41855178 CTTTCCACTCATTTCCAGCTTGG - Intronic
1107716829 13:43208383-43208405 ATTTCCAAACATTTGAAGCCTGG + Intergenic
1109306450 13:60647009-60647031 ACACCTACACATTCCCAGCCTGG + Intergenic
1112453671 13:99537392-99537414 ATTTAAACACTTTTCCTGCCTGG - Intronic
1114285526 14:21239209-21239231 GTTTAGTCACATTTCCAGCCAGG + Intronic
1115628544 14:35219885-35219907 TTTTCTAGCCATTTCCTGCCTGG - Intronic
1118840293 14:69504869-69504891 AATTCTATACATTTCAAGCAAGG + Intronic
1120856618 14:89217965-89217987 ATTTGTACCTTTTTCCAGCCTGG + Intronic
1122218381 14:100219394-100219416 CTTTCTATTCATTTCCAGCTCGG + Intergenic
1125177519 15:36841830-36841852 ATTTCTATACCTTTCCTGCTTGG - Intergenic
1125240180 15:37565112-37565134 ATTCCTACACATTTCAACCAGGG + Intergenic
1128389429 15:67173231-67173253 AGCACTACACATTTGCAGCCTGG + Intronic
1131610366 15:93954816-93954838 GATTCTTCACATTTCCAGTCCGG + Intergenic
1136688764 16:32012346-32012368 ATTTCTACATATTTCTAGCCGGG - Intergenic
1136789360 16:32955867-32955889 ATTTCTACATATTTCTAGCCGGG - Intergenic
1136880453 16:33898069-33898091 ATTTCTACATATTTCTAGCCGGG + Intergenic
1137626652 16:49913044-49913066 AGCTCCACCCATTTCCAGCCAGG + Intergenic
1137781273 16:51099617-51099639 TTATCTCCCCATTTCCAGCCTGG + Intergenic
1139251639 16:65502176-65502198 ATTTCAGCACATTACCAGCCTGG + Intergenic
1139472738 16:67186929-67186951 ATGTCTACCCATCTCCAGCAGGG - Intronic
1140703458 16:77604003-77604025 ATTTATACACATTTCTGCCCGGG - Intergenic
1141377044 16:83540994-83541016 ATTTCTACATCTTTTCACCCTGG - Intronic
1203091557 16_KI270728v1_random:1217362-1217384 ATTTCTACATATTTCTAGCCGGG - Intergenic
1145884084 17:28370862-28370884 ATTTACCCAAATTTCCAGCCTGG - Intronic
1147151614 17:38518532-38518554 ATTTCTACATATTTCTAGCCAGG - Intergenic
1151096397 17:71503891-71503913 ATTCCTCCACAATTCCTGCCAGG + Intergenic
1153406381 18:4745041-4745063 ATTTTTAAAAATTGCCAGCCTGG - Intergenic
1153513334 18:5879329-5879351 ATTTGTTCACATTTCCAGGATGG + Intergenic
1153547364 18:6221581-6221603 ATTTCTACAAATTGCAAGTCAGG - Intronic
1159646271 18:70921775-70921797 ATTGCAACACTTTTCCAGCAAGG + Intergenic
1159647763 18:70939997-70940019 ATTTTCCCACATTTCCATCCTGG + Intergenic
1160392622 18:78546777-78546799 ATTTCTCCTCATTTCCAACTAGG - Intergenic
1164907562 19:31979702-31979724 ATTTGAGCATATTTCCAGCCTGG - Intergenic
1202648557 1_KI270706v1_random:161261-161283 ATTTCTCCACATTTCCGGTGAGG - Intergenic
928482564 2:31697364-31697386 ATTTCAACACATGCCCAACCTGG + Intergenic
929059930 2:37913766-37913788 ATTTCCATACATTTCCTGACTGG - Intergenic
930581371 2:53216499-53216521 ATTGCAACACTTTTCCAGCAAGG - Intergenic
930628127 2:53721357-53721379 GTTTCACCACATTTCCAGGCTGG - Intronic
931007352 2:57866808-57866830 GTTAATACACATTTCCAACCAGG - Intergenic
931187624 2:59968799-59968821 GTTTCTCCACAACTCCAGCCAGG + Intergenic
935039453 2:99411936-99411958 AATTCAAGACATATCCAGCCGGG + Intronic
935671283 2:105559284-105559306 ATTGCTAAACATTTCCTGCATGG - Intergenic
937021727 2:118663397-118663419 GTTTCATCACATTGCCAGCCTGG + Intergenic
939251941 2:139692890-139692912 ATTTCCATAAATTCCCAGCCTGG - Intergenic
939302839 2:140368718-140368740 ATTTCTATTCATTTCCAATCAGG - Intronic
939533936 2:143400930-143400952 ATCTCTCCACATTCCAAGCCTGG + Intronic
941648728 2:168069803-168069825 ATTTTTAAAGGTTTCCAGCCAGG + Intronic
944360912 2:198855285-198855307 TTTTCTACATATTGCTAGCCAGG - Intergenic
946525736 2:220518025-220518047 ATATCTCTTCATTTCCAGCCTGG + Intergenic
946993650 2:225365238-225365260 ATTTCAAACCATTTCCAGCTGGG + Intergenic
947260667 2:228218544-228218566 TTTTCTACATATTGCTAGCCAGG - Intergenic
947373589 2:229473157-229473179 ATTTTAACAGCTTTCCAGCCTGG + Intronic
947894235 2:233654672-233654694 ATTTCTAAGCATTTCCTGCAGGG + Intronic
948321217 2:237071430-237071452 AGTTCTACTCATTCCCACCCAGG - Intergenic
948796274 2:240403785-240403807 ATTTCTTCACCTGCCCAGCCAGG - Intergenic
1169560571 20:6796017-6796039 AATACTATACATTTTCAGCCAGG + Intergenic
1169611900 20:7390479-7390501 GTTTCAACACTTTTCCAGCAAGG + Intergenic
1170095649 20:12643037-12643059 ATTTCTCTCCCTTTCCAGCCAGG - Intergenic
1170307636 20:14957648-14957670 ATTCCTGCCTATTTCCAGCCTGG - Intronic
1170476076 20:16715776-16715798 ATTTCTACACACAAACAGCCTGG - Intergenic
1170987162 20:21268980-21269002 ATTTCTCCATGTATCCAGCCTGG - Intergenic
1174058542 20:47816313-47816335 ATTTCTATACATATTGAGCCAGG - Intergenic
1174794615 20:53511603-53511625 ATATATACATATATCCAGCCGGG + Intergenic
1175328367 20:58145628-58145650 AACTGTCCACATTTCCAGCCAGG + Intergenic
1176603296 21:8811426-8811448 ATTTCTCCACATTTCCGGTGAGG + Intergenic
1178573314 21:33761360-33761382 ATTAAAACACATTTCCAGCCTGG - Intronic
1183036234 22:35142880-35142902 ATTTCTATACATTTCCCATCTGG + Intergenic
1183909682 22:41069062-41069084 CTTTCTCCACATTTCTAGCATGG + Intergenic
952497271 3:33926816-33926838 ATTTCAACACCTTTCCAGACTGG - Intergenic
956196813 3:66661387-66661409 ATTTCTACACATCCCCAGAGTGG + Intergenic
956264523 3:67382041-67382063 GTTTCTACATATTTCCAGACTGG - Intronic
956393963 3:68804737-68804759 CTTTCTACACATGGCTAGCCAGG - Intronic
961741039 3:129033296-129033318 ATTTCCACAGCTCTCCAGCCTGG + Intronic
962811228 3:138960898-138960920 ATTTCTCCATTTTTCCTGCCTGG + Intergenic
963374935 3:144452246-144452268 ATCTATACCCATTTCCAGCTAGG + Intergenic
963430852 3:145200726-145200748 ATTTCTTCACATTTCAATCTTGG - Intergenic
964829460 3:160867505-160867527 CTTTCTTCACATTTCCTTCCTGG + Intronic
964902757 3:161679634-161679656 ATTTCTCAAAATTTCCAGCGTGG + Intergenic
966070100 3:175865530-175865552 ATTTTTGCTTATTTCCAGCCTGG + Intergenic
966071504 3:175884769-175884791 ATTGCAACACATCTCCAGCAAGG - Intergenic
970279770 4:14441967-14441989 ATTTTTACAACTTTCCAGACAGG + Intergenic
970786532 4:19803930-19803952 ATTTCTACCCTTTTCAATCCAGG + Intergenic
973113489 4:46425285-46425307 ATATGTTCAAATTTCCAGCCTGG - Intronic
974017858 4:56665251-56665273 ATTTCAAAACAATTTCAGCCAGG - Intronic
977802457 4:101252722-101252744 TTCTTTACACATTTGCAGCCTGG + Intronic
977925426 4:102695057-102695079 CTTTCTACAAATTCCCATCCAGG - Intronic
978102585 4:104860714-104860736 AGTTCTACACATTTCCAGCAGGG - Intergenic
980748454 4:137054876-137054898 ATGTCTACACATTGCCATCTTGG + Intergenic
983315945 4:166133544-166133566 ATTGCAACACCTCTCCAGCCAGG - Intergenic
983617394 4:169723322-169723344 ATTTCTACACTTTGCAAGCAAGG + Intronic
983846359 4:172524458-172524480 ATAGCTACTCACTTCCAGCCTGG - Intronic
986673147 5:10160909-10160931 ATGTCTACACAGTTCCAACTTGG + Intergenic
987898768 5:23983307-23983329 TTTTCTTCAAATTTCCAGGCTGG + Intronic
989824184 5:45834048-45834070 CTTTCTACACATGGCTAGCCAGG + Intergenic
992865214 5:80951084-80951106 ATTTGTCCCCATTTCCAGGCAGG + Intergenic
993379781 5:87193279-87193301 CTTTCTTCACCTTTCCTGCCTGG + Intergenic
993841218 5:92881269-92881291 ATTTTTACACATTCTAAGCCAGG + Intergenic
995609788 5:113897275-113897297 ATTTCTTCACATTTCCATTTCGG - Intergenic
996310113 5:122094918-122094940 GGTTCTACACATTTCCATCTTGG - Intergenic
996590542 5:125141874-125141896 ATTTATATACATATACAGCCTGG - Intergenic
997545168 5:134700024-134700046 ATTTCTCCACATTATCAACCTGG + Intronic
998681395 5:144471464-144471486 ATTTCTACACTTTTCCAAAAAGG + Intronic
999658530 5:153834209-153834231 ACTTCTGCACACTTCCATCCTGG - Intergenic
1002302867 5:178267377-178267399 GTTTCTTCACATTTCCCGTCGGG + Intronic
1002878093 6:1228795-1228817 TTTTCTGAATATTTCCAGCCTGG + Intergenic
1003561865 6:7187034-7187056 ATTTCTCCCCAAGTCCAGCCTGG - Intronic
1003665551 6:8108193-8108215 ACTTCTAGACACTTCCTGCCTGG + Intergenic
1003711878 6:8602117-8602139 AAGTCTACACATTTCCAGGCTGG - Intergenic
1005089687 6:22043450-22043472 ATGTTTACAGATATCCAGCCAGG + Intergenic
1006315893 6:33291441-33291463 TTTTATACACATTTGCAGCAAGG + Intronic
1008698933 6:54075615-54075637 TTTTTTAAACATTTCCAGTCTGG - Intronic
1009880279 6:69558583-69558605 ATTGCTACAAATTTTAAGCCAGG - Intergenic
1011262958 6:85487595-85487617 ATTTCAAAACATTTTTAGCCAGG + Intronic
1011273597 6:85605116-85605138 AGTGCCACAGATTTCCAGCCTGG + Intronic
1012264269 6:97121966-97121988 ATTTTTGCACATTCCCAGCAGGG - Intronic
1012820284 6:104078352-104078374 ATTTCATCATATTTCCAGACTGG + Intergenic
1014410535 6:121113560-121113582 AGTCCTACACATTTCCAGAGTGG - Intronic
1016288866 6:142506264-142506286 ATTTTCTCACATTTGCAGCCAGG + Intergenic
1020486533 7:8727544-8727566 CTTTCTACATATTGCTAGCCAGG + Intronic
1021724100 7:23532899-23532921 ATATATACACGATTCCAGCCGGG - Intergenic
1022813684 7:33893742-33893764 ATTTTTGCACATTTCCATCATGG - Intergenic
1023994121 7:45148458-45148480 GTTTCTGCACAGGTCCAGCCCGG + Intergenic
1031081959 7:117266901-117266923 ATTTCTAGGCATTTGTAGCCAGG + Intergenic
1031087020 7:117312391-117312413 ATTTGTCCACTCTTCCAGCCTGG - Intronic
1032783650 7:135184169-135184191 ATTTTTACCCATTTCTACCCTGG - Exonic
1033808321 7:144979431-144979453 ATTTCTACTTATTTCCAGGTGGG + Intergenic
1035015843 7:155765304-155765326 GTTACTACTGATTTCCAGCCAGG + Intronic
1036048976 8:5174522-5174544 ATTACTAAATATTTCCATCCAGG - Intergenic
1038716909 8:29999288-29999310 TCTTCTAAACATTCCCAGCCGGG - Intergenic
1039370241 8:36977277-36977299 AAAACTACACATTTTCAGCCGGG + Intergenic
1040614067 8:49017571-49017593 ATTTCTACACCTCTCCAGCAAGG - Intergenic
1040722121 8:50337465-50337487 ATTTCTACCCGTTTCCTGCAAGG + Intronic
1041284889 8:56250324-56250346 ATGTCTATGCATTTCCATCCAGG + Intergenic
1041482106 8:58332825-58332847 ATTGCAACACATCTCCAGCAAGG + Intergenic
1041821200 8:62035452-62035474 ATTTGTGTACATTTCCAACCTGG + Intergenic
1044883453 8:96748360-96748382 ATTTTTACCCACATCCAGCCAGG + Intronic
1045540290 8:103077799-103077821 CTTCCTACCCATTCCCAGCCAGG - Intergenic
1048338672 8:133522422-133522444 ATTGCAACACATTTCCAGAGGGG - Intronic
1048794455 8:138137169-138137191 AGTTTTACACATTTCAATCCTGG + Exonic
1049448110 8:142641007-142641029 ATTTCTCCCCATCCCCAGCCTGG + Intergenic
1049552360 8:143266551-143266573 ATTTTTACATATTATCAGCCTGG + Intronic
1049743687 8:144253596-144253618 ATTTGTCCACGTTTCCTGCCAGG + Intronic
1050533579 9:6611161-6611183 CCTTCTAAACATTTCCATCCTGG - Intronic
1050650272 9:7768355-7768377 ATTTCTACATATAGCTAGCCAGG + Intergenic
1051003513 9:12314566-12314588 ATTACAACACATTTCTAGCAAGG - Intergenic
1052011965 9:23421240-23421262 ATTGCTACACAGTACCAGTCAGG + Intergenic
1052770067 9:32679391-32679413 CATTCTACCCACTTCCAGCCTGG - Intergenic
1052946722 9:34174324-34174346 ATTTTTAAACATTATCAGCCCGG + Intergenic
1054993012 9:71352168-71352190 AGATCTTCTCATTTCCAGCCGGG - Intronic
1057396020 9:94681084-94681106 ATAACTCCAGATTTCCAGCCTGG - Intergenic
1058250261 9:102685690-102685712 ATTGCTACAATTATCCAGCCAGG - Intergenic
1058467862 9:105245815-105245837 TTGTCTAAACATTTCCACCCAGG - Intronic
1059284825 9:113163238-113163260 ATTTCCAAAGATTTCAAGCCAGG + Exonic
1187171405 X:16855602-16855624 ATTACTACCAATTCCCAGCCTGG + Intronic
1188744719 X:33828817-33828839 ATCTCAACACATTTCCAGCAAGG - Intergenic
1188851477 X:35137832-35137854 ATTTCTACACTTTTAAAGTCAGG - Intergenic
1194066899 X:89271735-89271757 ATTTCACCACATTTGCAGCAGGG - Intergenic
1195009146 X:100718353-100718375 ATTTATACACTGTTCCAGACAGG + Intronic
1195153541 X:102098175-102098197 ATTGCAACACATCTCCAGCAAGG + Intergenic
1199940790 X:152625719-152625741 ATTTCTTTACATTTCCAGTTTGG - Intergenic
1200291243 X:154876412-154876434 ATTTTTTAAAATTTCCAGCCGGG - Intronic
1200721064 Y:6605894-6605916 ATTTCACCACATTTGCAGCAGGG - Intergenic