ID: 904021514

View in Genome Browser
Species Human (GRCh38)
Location 1:27470102-27470124
Sequence CAGTGTCAGCAGAAGCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904021514 Original CRISPR CAGTGTCAGCAGAAGCACAA AGG Intronic
901390971 1:8945894-8945916 CAGGGACAGCAGAAGCACCAGGG - Exonic
902300916 1:15502223-15502245 CAGAGGCTGCAGGAGCACAAAGG + Intronic
902582445 1:17416672-17416694 CAGCAGCAGCACAAGCACAAGGG + Intronic
903121101 1:21217604-21217626 TAGTGTCAGCACCAGCACCATGG - Intronic
903864202 1:26386364-26386386 CAGTGTCAGCAGAAGTCTTAGGG + Intergenic
904021514 1:27470102-27470124 CAGTGTCAGCAGAAGCACAAAGG + Intronic
904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG + Intergenic
904635606 1:31878436-31878458 CTGTGGCTGCAGCAGCACAAAGG + Intergenic
905049429 1:35037114-35037136 CAGCGTAAGCAGAAGCCCCAAGG - Intergenic
905756504 1:40514570-40514592 CAGTGTCAGCAGAAGCCTCAGGG + Exonic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
907053056 1:51342729-51342751 AAGTTCCAGCTGAAGCACAAAGG + Intronic
907373173 1:54016066-54016088 CAGTGTCCTCAGAAGCAGAATGG + Intronic
907440201 1:54474247-54474269 CAGCATCAGCAAAGGCACAAAGG - Intergenic
908844271 1:68308893-68308915 CAGTGCCAGCAGATACACAGTGG - Intergenic
908973594 1:69868475-69868497 CGGTGTTAGCAGAGGTACAAAGG + Intronic
909184196 1:72464759-72464781 CAGAGTCAGATGAAGCATAAAGG + Intergenic
911156420 1:94641922-94641944 CAGAGTCAGCACATCCACAAGGG + Intergenic
913079019 1:115364645-115364667 CAGAGTCAGCTAAAGTACAAAGG - Intergenic
916305739 1:163329583-163329605 CAGAGGGAGCAAAAGCACAATGG + Intronic
916337938 1:163694098-163694120 GAATGTCAGCCAAAGCACAAAGG + Intergenic
917796249 1:178534736-178534758 CAGCGTTAGCAAAGGCACAATGG - Intronic
917958593 1:180125167-180125189 AGGTGTGAGCAGAAGCAGAAAGG + Intergenic
918869951 1:189957528-189957550 TAGTGTCAGCAGAGGTCCAATGG - Intergenic
920823338 1:209401745-209401767 CAGTTTCAGCAGAACAATAAGGG + Intergenic
921261947 1:213392362-213392384 CAGTGGCAGCAAAAGCACCAGGG + Intergenic
921636331 1:217499008-217499030 CAGGGGCAGCTGAAGCAAAATGG - Intronic
922899239 1:229123437-229123459 AAGTGCCAACAAAAGCACAAAGG - Intergenic
923831051 1:237557743-237557765 TAGAATCAGCAGAAGGACAAAGG + Intronic
1063434953 10:6022076-6022098 CAGTCTCAGCTGAGACACAAGGG + Intronic
1065159341 10:22903020-22903042 CAGTCTCAGCAGCAGCAGAATGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1067329955 10:45305839-45305861 CAGTATCAGAGGAAACACAAAGG - Intronic
1067548909 10:47219515-47219537 CTTTGTCAGCAGAAACAAAACGG - Intergenic
1068855327 10:61791980-61792002 AAGTTTCAGCAGAAGTCCAAGGG + Intergenic
1069594743 10:69663284-69663306 CTGTGTCAGCAGGAGCCCACAGG - Intergenic
1069849043 10:71393262-71393284 CACAGGCAGCAGAAGCAGAAGGG - Intergenic
1070261080 10:74856475-74856497 CAATGTCTTCAGAAGCAAAAAGG - Intronic
1072544613 10:96426681-96426703 CAGATTCAGCAGAATCACAAAGG - Intronic
1073307169 10:102512184-102512206 CAGTGTCAGCAGAAGGATTTGGG + Intronic
1073922701 10:108477995-108478017 CAGTGTCAGCATCAGAACAAGGG - Intergenic
1075041858 10:119114422-119114444 CAGTGGCAGCAGAAGCCCGCAGG + Intronic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1076338852 10:129728831-129728853 CAGCGTCACCAGCATCACAAAGG + Intronic
1076501020 10:130936159-130936181 CAGTGTCAGCAGAGGCATATGGG - Intergenic
1076537185 10:131187190-131187212 CAGTGCCAGCAGAGGCACGTCGG + Intronic
1076540302 10:131210278-131210300 CAGTGTCAGCTCAAGGACCAAGG + Intronic
1076895882 10:133311718-133311740 CAGCCTCAGCAGAAGCCCCAGGG + Exonic
1077923361 11:6657001-6657023 CAGTTTCAGCTGAAGAAGAAGGG + Intergenic
1078188884 11:9075427-9075449 GAGCGTAAGCAGTAGCACAAAGG + Intronic
1082884224 11:58066715-58066737 CAGGGTCACCAGAAGAACAGAGG - Intronic
1083975824 11:66119071-66119093 CAGTGGCACCAGATGGACAAGGG + Intronic
1084118590 11:67056163-67056185 CAGTGTGATCAGAACTACAACGG - Intergenic
1085024645 11:73229440-73229462 CAGGGTCAGGAGAGGCAGAAGGG + Intronic
1085259712 11:75197481-75197503 CTGTTGGAGCAGAAGCACAAGGG + Intronic
1088003801 11:104916024-104916046 CAGTGTGAGAAGAAGCAAAAAGG + Intergenic
1088017503 11:105078481-105078503 CAGTGTGGGAAGAAGCACAAAGG + Intronic
1088020076 11:105108458-105108480 CAGTGTGGGAAGAAGCACAAAGG + Intergenic
1088806825 11:113360109-113360131 CAGAGTCAGCAGATTCTCAAAGG - Intronic
1089078881 11:115760177-115760199 CCGGGTCATCAGAAGCACAGTGG + Intergenic
1090921103 11:131206429-131206451 CTTTGTAAGCAAAAGCACAATGG + Intergenic
1091827878 12:3527608-3527630 CAATGACAGCAATAGCACAAAGG - Intronic
1092966447 12:13648217-13648239 CAGTTTCAGAAAAAGCTCAACGG + Intronic
1093748361 12:22769345-22769367 CAATTTCACCAGAAGCACTAAGG - Intergenic
1094020692 12:25910837-25910859 AAGAGTCAACAGAAGAACAATGG - Intergenic
1095262707 12:40115633-40115655 CAGTGGTAGCAGCAGCAGAAGGG + Intergenic
1095301849 12:40593527-40593549 CAGTGATGGCAGAGGCACAAGGG + Intergenic
1097422928 12:59403190-59403212 CAACGTCAGCAAAAGCAGAAAGG - Intergenic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1100451012 12:94706448-94706470 CAATCACAGCAGAAGAACAAGGG + Intergenic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1104476514 12:129074735-129074757 CAGTGACAGCAGACACACAGGGG - Exonic
1104693419 12:130845155-130845177 AAGTGCCAGGAGAAGCAGAAAGG - Intergenic
1105984816 13:25555122-25555144 GAGTGTTAGCAGAAGAACCATGG + Intronic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1107948407 13:45440547-45440569 CAGTGCCAACATAAGCACGAGGG - Intergenic
1109245921 13:59954728-59954750 TAGTCACAGCAGAAGGACAAAGG + Intronic
1109326045 13:60869499-60869521 CAGTGGCAGCAGCAACACAATGG + Intergenic
1110726993 13:78837393-78837415 CACTGTCACCAGAAGACCAATGG + Intergenic
1111137168 13:84063034-84063056 CACTGTCATGAGAAGAACAAAGG + Intergenic
1112162887 13:96887924-96887946 CAGTGTCAGAAGTAATACAAGGG - Intergenic
1113304856 13:109066388-109066410 CAGTTTCAGCAGAAAGAAAATGG - Intronic
1114931930 14:27482271-27482293 CAGTTTCAGCAAAAGCACAGAGG + Intergenic
1116592945 14:46803278-46803300 AAGTGTCTGTAGAAGCACCATGG + Intergenic
1117881695 14:60318988-60319010 CATTGTCAGGAGAAGCAAGAGGG - Intergenic
1118364431 14:65082361-65082383 GAGTGACAGCCGAAGCCCAATGG + Intronic
1121692131 14:95885550-95885572 AAGTGTGAGCAGAAGCACAGAGG + Intergenic
1122322411 14:100863093-100863115 CAGTGTCTGAAGAAGCTCAGAGG + Intergenic
1123186062 14:106518055-106518077 TAGTGTCAGGAGAAGGAGAAGGG + Intergenic
1124060957 15:26293483-26293505 CAAAGTCAGCAGAGACACAAAGG - Intergenic
1124065604 15:26340918-26340940 CCGTGGCAGGAGAAGCACAGTGG + Intergenic
1124186250 15:27531980-27532002 CACTGTCACCAGAATCACATGGG + Intronic
1125084746 15:35716695-35716717 CACAGTGAGAAGAAGCACAATGG - Intergenic
1125762730 15:42108303-42108325 CAGTCTCAGCAGAAGGTTAAAGG + Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1127234232 15:57030636-57030658 GAGTTTCAGCAGAAAGACAATGG - Intronic
1127284736 15:57522445-57522467 CAGTGACTGCACAAGAACAATGG - Intronic
1127732473 15:61813569-61813591 CCGAGTCACCAGAAGCACAGAGG - Intergenic
1128392947 15:67195396-67195418 CAGTGCCAGCAGAAGCCCCTGGG + Intergenic
1128796400 15:70469784-70469806 CAGTGTGTGCAAAGGCACAAAGG + Intergenic
1128803947 15:70516931-70516953 AAGTGGCAGCAGGAGGACAAGGG + Intergenic
1130537867 15:84799825-84799847 CAGTACCTGCAGAAGCACAGCGG - Exonic
1130917207 15:88314498-88314520 CAGGGTTAGCAGAAGGCCAATGG + Intergenic
1132984778 16:2759611-2759633 CAGAGTCAGCAGAAGTTGAACGG - Exonic
1133405424 16:5520536-5520558 CAGTCTCAGCAGAAGGATATAGG - Intergenic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1136276771 16:29183444-29183466 GGGTGTCAGGAGAAGCAGAAAGG - Intergenic
1136376904 16:29871274-29871296 GAGGGTCAGAAGAAGGACAAAGG - Exonic
1137730768 16:50687983-50688005 CAGAGTGAGCAGAAGCTCACAGG + Intergenic
1138599485 16:58046306-58046328 CACTGGCAGCTGAAGCCCAAAGG - Exonic
1140111895 16:72011914-72011936 CAGTGTCAGCGGAAGGCTAAGGG + Intronic
1140112059 16:72012892-72012914 CAGTGTCAGCGGAAGGCTAAGGG + Intronic
1140255419 16:73331491-73331513 CTGTGGCAACAGAAGAACAAAGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142081151 16:88149504-88149526 GGGTGTCAGGAGAAGCAGAAAGG - Intergenic
1143739307 17:8941077-8941099 GTGTGTCAGCAGCAGGACAATGG + Intronic
1143782537 17:9236808-9236830 CAGTGCCTGGAGAAGCACAGGGG + Intronic
1146007514 17:29169979-29170001 CGGTCACAGCAGCAGCACAAGGG + Intronic
1147264742 17:39227760-39227782 CAGTGGCAGAAGTAGGACAAGGG + Intergenic
1147772472 17:42877560-42877582 AAGTGTCAGCAGCAGCCCAGGGG + Intergenic
1148664741 17:49365902-49365924 CAGTGTCAGCAGCTGAACAAGGG - Intergenic
1149133040 17:53330702-53330724 CATTCTCAGGAGAAGCATAAAGG + Intergenic
1149553932 17:57559769-57559791 CAGTGTCTGCAGAAGGGCCAAGG + Intronic
1150533728 17:66013806-66013828 CAGTGGCAGCAGTGGCACCATGG + Intronic
1151183556 17:72347345-72347367 CAGTGTCACCATATGTACAATGG - Intergenic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1151467829 17:74299218-74299240 CAGAGGCAGCAGAGGTACAAAGG + Intronic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1154359779 18:13649863-13649885 CAGTGTGAGCAGGAGAGCAAAGG - Exonic
1157556607 18:48616881-48616903 CAGTGTGAGCAAAAGCACAGAGG + Intronic
1157632254 18:49109926-49109948 GTGTGTCAGCAGTAGCACAAAGG - Intronic
1158260392 18:55599892-55599914 CAGTGGCAACAGAAGTTCAATGG - Intronic
1159481336 18:68994583-68994605 CACTGTCAGAAGAACCACAAGGG - Intronic
1160231925 18:77055232-77055254 CAGGGTCAGCAGAAACCCAGAGG + Intronic
1161579817 19:5074713-5074735 GGGTGTCAGCAGAAGCACCGTGG + Intronic
1161811733 19:6475391-6475413 CAGGGACACCTGAAGCACAAGGG + Exonic
1161839706 19:6672127-6672149 CAGAGTGAGCAAAAGCACGAGGG - Intergenic
1162409882 19:10499347-10499369 CAGTGTCAGGAGAAGGACCAGGG - Intronic
1163671231 19:18629914-18629936 CAGTGCCAGAAAAAGCTCAAGGG - Intergenic
1164828750 19:31303782-31303804 TGGTGCCAGCAGAAGCACATGGG + Intronic
926669703 2:15564762-15564784 CAGTGTCACTACAAGCACGAGGG - Intergenic
926786125 2:16520077-16520099 GAGTCTCAGCAGAATCACAGGGG - Intergenic
927579428 2:24228730-24228752 CTGTGTCAGCAGAACAAAAAGGG + Intronic
929090400 2:38210887-38210909 CAGTGTCAGCAGAGACAACATGG + Intergenic
930250442 2:49028722-49028744 CAGTGTATGGAGAAGCACAATGG - Intronic
931083897 2:58807572-58807594 GAGTGACTGCAGAAGCAGAAGGG - Intergenic
932504561 2:72216183-72216205 CACTGTAAGATGAAGCACAAAGG + Intronic
932672065 2:73746444-73746466 ACCTGTCAGCAGAAGCTCAAGGG + Intergenic
934996564 2:98967135-98967157 CAGTGGCAGCAGCAGCACACTGG + Intergenic
937694266 2:124790066-124790088 AAGTGTGTGGAGAAGCACAATGG + Exonic
938081820 2:128374243-128374265 CAGAGGCAGCAGGAGCACCAAGG + Intergenic
938235640 2:129704256-129704278 GAGGGTCAGCACAAGCACACAGG - Intergenic
938317661 2:130341207-130341229 CAGTCTCATCTGAATCACAAGGG - Intronic
939948841 2:148444279-148444301 CAGTGGAAGCAGAAGCCAAAAGG - Intronic
940627888 2:156198790-156198812 CAGTGACAGCAGAATCACTTTGG - Intergenic
942321209 2:174737514-174737536 CAGTCTCTGCCCAAGCACAAGGG - Intergenic
942371970 2:175294952-175294974 CAGTAGAAGCAGAAGCACACAGG - Intergenic
942712113 2:178848268-178848290 CAGTGAATGCAGAAGCACAATGG + Intronic
942849872 2:180471918-180471940 CTGTGTCACCTGAAGCACCAGGG + Intergenic
944709039 2:202319329-202319351 CAGGGTCACCAGCAGCACCATGG + Intergenic
944846254 2:203671213-203671235 CAGTGGTAGCAGAAGAACAATGG - Intergenic
946637149 2:221742136-221742158 CTGTGACAAAAGAAGCACAAAGG + Intergenic
946855902 2:223949385-223949407 CAGGGTCAGCAGATGCTCACTGG + Intergenic
948781082 2:240322353-240322375 CAGTGTCAAAAGAAGGGCAAAGG + Intergenic
948982098 2:241499590-241499612 CACTGCCAGCAGGAGCCCAACGG + Intronic
949055192 2:241924168-241924190 CAGAGTCACCACCAGCACAAAGG - Intergenic
1169250572 20:4057774-4057796 CAATGTCAGCAGGAGCTCAAAGG - Intergenic
1170130174 20:13010756-13010778 CAGGGTCAGAATAATCACAAGGG - Intronic
1171210722 20:23314907-23314929 CAGTGCCAGGAAAAGCACAAAGG + Intergenic
1172582957 20:36063265-36063287 CATAGTCAGCAGAAGCAAAGAGG + Intergenic
1173497201 20:43528400-43528422 CACTGTCAGCAGAAGTACTCTGG - Intronic
1174220863 20:48954111-48954133 CAGTGTCCACAGGAGGACAAGGG + Intronic
1174778365 20:53366057-53366079 CAGTGTCAGAAGAAAAAGAAGGG + Intronic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1175842723 20:62040426-62040448 CAGTGACAGCAGCAGCTCAGTGG + Intronic
1178990056 21:37345674-37345696 CAGTGTCATGAGAAGCAAAAAGG + Intergenic
1181665892 22:24396752-24396774 CAATGGCAGCAGAAGTACAGAGG - Intronic
1183831849 22:40422404-40422426 GAGTGTGAGGAGAAGCACATTGG + Intronic
1184332975 22:43837623-43837645 CAGTGGAAGCAGAGGCTCAAGGG + Intronic
1184380093 22:44140053-44140075 CAGTTTCACAAGCAGCACAATGG - Intronic
1184380580 22:44142855-44142877 CTGCGTCAGCAGAAGCAGCAAGG - Intronic
1184381414 22:44147098-44147120 CAGTGTCAGCAGGAGCAGCTGGG + Intronic
1184650304 22:45916555-45916577 CAGTGCCAGGAGAAGCCCAGTGG - Intergenic
1184724728 22:46336902-46336924 CAGTGCAAGCAGAATCACAGAGG + Intronic
951573014 3:24085142-24085164 CAGTGTCAAGAGAAGCACCATGG + Intergenic
952186575 3:30975853-30975875 CAGTGTAAGCAGGAGAACCAGGG - Intergenic
953141620 3:40234475-40234497 CAGTGTCTCCAGCAGCCCAAAGG + Intronic
954034573 3:47844380-47844402 CACTGTGAGCAGAAGCACCTTGG + Intronic
955484656 3:59423490-59423512 CAGTGACAGCTGAAGCAGAAAGG + Intergenic
956470337 3:69559916-69559938 GAGTGTCATCAGAAGCCCAGAGG - Intergenic
957168589 3:76708334-76708356 CAGAGGGAACAGAAGCACAACGG + Intronic
960246284 3:115403941-115403963 CAGAGTCAGCAGGAGCTTAAGGG + Intergenic
960963863 3:123091096-123091118 CAGTCCCAGCAGTAGAACAATGG + Intronic
961059556 3:123816924-123816946 CACAGCCAGCAGAAGGACAAAGG + Intronic
961325805 3:126108582-126108604 CAGTGACAGCAGCAGTGCAATGG + Intronic
961504022 3:127358271-127358293 CAGTGCCAGCAGAGGAACAGAGG - Intergenic
962596320 3:136948272-136948294 CAGTATCACTAAAAGCACAAGGG + Exonic
962731110 3:138284414-138284436 CAGTGTCTGGAAAAGAACAAAGG - Exonic
964158113 3:153611682-153611704 CTTTGTCAGAAGAAGCCCAATGG + Intergenic
967952103 3:194849082-194849104 CAGTGTCATCAGGACCACAGCGG - Intergenic
968257653 3:197292002-197292024 CAGTCTCACCAGCAGCACACAGG - Intronic
968495551 4:913458-913480 GAGATTCAGCAGAAGCAAAAGGG + Intronic
971154638 4:24068332-24068354 CAGTATCTGCAGAAGCCCAGAGG + Intergenic
973577529 4:52305623-52305645 GACTGTTAGCAGAAGCCCAATGG - Intergenic
977241017 4:94569175-94569197 CAGTGTCAACCCAAGCAAAATGG - Intronic
977696577 4:99972237-99972259 CAGAGGCAGCAGCAGCACAGGGG - Intergenic
979852558 4:125591772-125591794 CACTGTCACCAGAACAACAAGGG + Intergenic
980002033 4:127500917-127500939 GAGTGTTAGCAGAAGCCTAACGG - Intergenic
981491770 4:145347265-145347287 GAGTGACAGAAGAAGCTCAATGG + Intergenic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
982797810 4:159666308-159666330 CAGTGTCAGTAGAGACACATGGG - Intergenic
986040968 5:3993756-3993778 CAGTGTCTGAGGAAGCACACAGG + Intergenic
986195442 5:5533432-5533454 CAGTGTCAGCAGACACTCAGTGG + Intergenic
990163002 5:52964042-52964064 CAGAGTCATGAGAAGCTCAAAGG + Intergenic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
995250210 5:109984461-109984483 CACTGTCACTAGAACCACAAGGG - Intergenic
996022159 5:118603293-118603315 CAGTGCAAGCAGGAGTACAAGGG - Intergenic
996249463 5:121311048-121311070 CTGTTTCAGGAGAAGTACAAAGG + Intergenic
996855203 5:127998158-127998180 TACTGTCAGGAGAAGCAGAAAGG - Intergenic
996976518 5:129440826-129440848 CCCTTTCAGCAGAAGCAGAATGG + Intergenic
997081422 5:130743996-130744018 CAGTGTCATCAGAAGGATATAGG - Intergenic
998137252 5:139680595-139680617 CAGTGGCAGCAGTGGCCCAAAGG + Exonic
998538307 5:142954778-142954800 CAGTGTCTCCATAAGGACAAAGG - Intronic
998872331 5:146565045-146565067 AAGTATGAGCAGATGCACAAAGG - Intergenic
1000015366 5:157271180-157271202 CAGTTTGAGCAAAGGCACAAAGG + Intronic
1000029735 5:157391191-157391213 CAGTGACAGCAGAGGCACTGAGG + Intronic
1000624856 5:163527331-163527353 CAGTGGAAGCACAAACACAATGG - Intergenic
1000814163 5:165899657-165899679 GAGAGTCAGCAGAATCACATGGG + Intergenic
1001073525 5:168606936-168606958 CAGTGTCATGAGAAGCTCAATGG - Intergenic
1001711975 5:173786373-173786395 CAGTGGCAGCAGAAGGCCAAGGG - Intergenic
1001735423 5:173994555-173994577 CAGTGGCAGCGGAGGCAGAATGG + Intronic
1002161649 5:177317531-177317553 CACAGTCAGCAGAAGGGCAATGG - Intergenic
1002326051 5:178407114-178407136 CAGTGTCAGTGGAAGCCCCATGG + Intronic
1002767979 6:259293-259315 CAGTGTCAGCAGCAGGGAAAGGG - Intergenic
1003564920 6:7214709-7214731 CAGAGGCAGCAGAACCACAGTGG + Intronic
1003938745 6:11003120-11003142 AAGTGACAGCAGCAGCAGAAGGG - Intronic
1006171400 6:32095464-32095486 CAGGGGCAGCAGAACCACAGGGG - Intronic
1006883820 6:37363129-37363151 CAGAGTCTGCAGAAGAACAAAGG - Intronic
1007339920 6:41184885-41184907 CAGCAGCAGCAGCAGCACAACGG + Intergenic
1011017268 6:82770728-82770750 CTGTGTCAGGATAAGGACAAAGG - Intergenic
1011221428 6:85058309-85058331 AAGTCTCAGAAGAAGCAGAAGGG + Intergenic
1011401684 6:86969703-86969725 CAGTGCCATCAGAAGCACGTGGG - Intronic
1013896219 6:115091621-115091643 CAGAGTGAGCAAAGGCACAATGG - Intergenic
1014986285 6:128014330-128014352 CAGTGTCACTGAAAGCACAAGGG + Intronic
1019526737 7:1483755-1483777 CAGCGTCAGCAGGATCACCATGG + Exonic
1019713582 7:2528481-2528503 CAGGGTCAGGAGAGGCACACAGG + Intronic
1020770292 7:12383557-12383579 CAGTTTCATCAGAACCACATGGG + Exonic
1021191898 7:17630474-17630496 CAGTGTCAACACATCCACAAGGG + Intergenic
1022010340 7:26303193-26303215 CAGCAACAGCTGAAGCACAAAGG - Intronic
1024663732 7:51524108-51524130 CAGTTTCTTCATAAGCACAATGG - Intergenic
1025241427 7:57279493-57279515 TAGTGCCAGCAGAGGCACCAAGG - Intergenic
1026166124 7:67911325-67911347 CAGTGCCAGCAGAGGCACCAAGG - Intergenic
1029144362 7:98435211-98435233 CAATGTCAGGAGAAATACAAAGG - Intergenic
1030184033 7:106741926-106741948 CAGTTTTAGCAGAAGGATAAAGG - Intergenic
1031226096 7:119040011-119040033 CAGTGTTAGGAGAAACAGAAAGG - Intergenic
1031985415 7:128161527-128161549 GAGTGTGAGGTGAAGCACAAAGG - Intergenic
1033808043 7:144976824-144976846 CAGTGCTAGCTGAAGCACTAAGG - Intergenic
1034373391 7:150621578-150621600 CAGTGACAGCAAAGACACAATGG + Intergenic
1034997215 7:155585300-155585322 CTGTGTTATCAGAAGCACACAGG + Intergenic
1035146641 7:156824290-156824312 CAGTCTCAGCAGAAGCTTACGGG + Intronic
1035489852 7:159265393-159265415 TAGTGTCAGCATCAGCACAGAGG + Intergenic
1036118052 8:5981730-5981752 GAATATCAGCATAAGCACAATGG + Intergenic
1036207564 8:6816132-6816154 AAGTGTCTGCAGAATCATAAAGG + Intronic
1036410150 8:8492397-8492419 CAGTGTCAGGAGGAGGACAGAGG + Intergenic
1039263765 8:35802414-35802436 CTGTGTCAGCAGGATCACACTGG + Intergenic
1040920235 8:52607971-52607993 CAGTGTCAACAGAAACAAAAGGG + Intergenic
1041231921 8:55761326-55761348 CCATGTGAGCAGAAGCACAAAGG - Intronic
1043031010 8:75133500-75133522 CAGCAGCATCAGAAGCACAAGGG - Intergenic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1043443487 8:80297609-80297631 CAGTGCCAGATGAAGGACAAAGG + Intergenic
1044143116 8:88679002-88679024 AAGTGTCACCAGAAGCTCACAGG + Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1048119392 8:131563124-131563146 ATGTGTCAGCAGCAGCACATGGG + Intergenic
1049207044 8:141368427-141368449 GAGTATCAGCAGAAGCACACGGG - Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1050934491 9:11377978-11378000 TAGTGTAAGCAGAGACACAATGG + Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1052636190 9:31108082-31108104 CAATGTAGGCAAAAGCACAATGG - Intergenic
1053164565 9:35835313-35835335 CAGGGTGGGCAGCAGCACAAGGG + Intronic
1054839706 9:69723418-69723440 CAGTTTCAACAGAAGAACCAAGG - Exonic
1054997310 9:71407249-71407271 AAGTGTGAGCTGAAGCACAGTGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057641747 9:96830381-96830403 CAGTGTCAGTAGAAGCCCCATGG + Intronic
1057671517 9:97094232-97094254 GAGTGTAAGAAGAAGCACAGTGG + Intergenic
1058375228 9:104315141-104315163 CAGTTTGAGCAGAGGCCCAAAGG - Intergenic
1059520298 9:114934441-114934463 CAGTGGCAGCAGTAGCACCTGGG + Intergenic
1060164152 9:121395211-121395233 TAGTGTTGGCAGAAACACAATGG + Intergenic
1060405396 9:123370558-123370580 CAGTCTCAGGACAAGCACAGTGG - Exonic
1061513986 9:131077908-131077930 CAGTGTCATCAGATGGACACGGG + Intronic
1062432993 9:136534276-136534298 CAGTGTCAACAGAATGTCAAGGG + Intronic
1186249147 X:7647283-7647305 AAGTGTCAGCAGACAGACAAGGG - Intergenic
1186410157 X:9339729-9339751 CAGTTTCAACAGAAGCATAAAGG - Intergenic
1186508395 X:10111823-10111845 CAGTGTCATCAGCAGCAAATGGG + Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1188130913 X:26431423-26431445 TGGTGTCCACAGAAGCACAAGGG + Intergenic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1190783331 X:53620147-53620169 CGGTGTTACCAGAAGCCCAAAGG - Intronic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1193584713 X:83306787-83306809 CTATGTCACCAGAAGCAGAATGG + Intergenic
1193644274 X:84047633-84047655 CAGTGTCAGCAGCAGCCCCAGGG + Intergenic
1194525900 X:94977537-94977559 AAGTGGCAGCAGCAGCACAATGG + Intergenic
1196696063 X:118613320-118613342 CAGTGGCAGCAGAAGTATAAAGG + Intronic
1197177322 X:123499982-123500004 CACTGGCAGCAGCAGCACAATGG + Intergenic
1197650180 X:129055746-129055768 CAGAGTCAGAAGAAGCACTCTGG + Intergenic
1197779390 X:130144507-130144529 CAGCATAAGCAAAAGCACAAGGG - Intronic