ID: 904026097

View in Genome Browser
Species Human (GRCh38)
Location 1:27504676-27504698
Sequence AGCAGGCAGTATCCCGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026097_904026101 -4 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026101 1:27504695-27504717 TGCTTCCCTCTGGTGAGAATGGG No data
904026097_904026107 4 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026107 1:27504703-27504725 TCTGGTGAGAATGGGGAGGAGGG No data
904026097_904026112 17 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026112 1:27504716-27504738 GGGAGGAGGGAGGCAGGGGCAGG No data
904026097_904026103 0 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026103 1:27504699-27504721 TCCCTCTGGTGAGAATGGGGAGG No data
904026097_904026102 -3 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026102 1:27504696-27504718 GCTTCCCTCTGGTGAGAATGGGG No data
904026097_904026108 7 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026108 1:27504706-27504728 GGTGAGAATGGGGAGGAGGGAGG No data
904026097_904026100 -5 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026100 1:27504694-27504716 CTGCTTCCCTCTGGTGAGAATGG No data
904026097_904026110 12 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026110 1:27504711-27504733 GAATGGGGAGGAGGGAGGCAGGG No data
904026097_904026111 13 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026111 1:27504712-27504734 AATGGGGAGGAGGGAGGCAGGGG No data
904026097_904026106 3 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026106 1:27504702-27504724 CTCTGGTGAGAATGGGGAGGAGG No data
904026097_904026113 22 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026113 1:27504721-27504743 GAGGGAGGCAGGGGCAGGCCTGG No data
904026097_904026109 11 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026109 1:27504710-27504732 AGAATGGGGAGGAGGGAGGCAGG No data
904026097_904026114 26 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026114 1:27504725-27504747 GAGGCAGGGGCAGGCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026097 Original CRISPR AGCAGGCAGTATCCCGCCCA AGG (reversed) Intergenic
No off target data available for this crispr