ID: 904026099

View in Genome Browser
Species Human (GRCh38)
Location 1:27504693-27504715
Sequence CATTCTCACCAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026099_904026116 22 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026116 1:27504738-27504760 GCCTGGCCGGCTGAGGTCACAGG No data
904026099_904026110 -5 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026110 1:27504711-27504733 GAATGGGGAGGAGGGAGGCAGGG No data
904026099_904026115 15 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026115 1:27504731-27504753 GGGGCAGGCCTGGCCGGCTGAGG No data
904026099_904026108 -10 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026108 1:27504706-27504728 GGTGAGAATGGGGAGGAGGGAGG No data
904026099_904026111 -4 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026111 1:27504712-27504734 AATGGGGAGGAGGGAGGCAGGGG No data
904026099_904026118 26 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026118 1:27504742-27504764 GGCCGGCTGAGGTCACAGGAAGG No data
904026099_904026112 0 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026112 1:27504716-27504738 GGGAGGAGGGAGGCAGGGGCAGG No data
904026099_904026114 9 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026114 1:27504725-27504747 GAGGCAGGGGCAGGCCTGGCCGG No data
904026099_904026109 -6 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026109 1:27504710-27504732 AGAATGGGGAGGAGGGAGGCAGG No data
904026099_904026113 5 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026113 1:27504721-27504743 GAGGGAGGCAGGGGCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026099 Original CRISPR CATTCTCACCAGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr