ID: 904026104

View in Genome Browser
Species Human (GRCh38)
Location 1:27504700-27504722
Sequence TCCTCCCCATTCTCACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026104_904026115 8 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026115 1:27504731-27504753 GGGGCAGGCCTGGCCGGCTGAGG No data
904026104_904026113 -2 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026113 1:27504721-27504743 GAGGGAGGCAGGGGCAGGCCTGG No data
904026104_904026116 15 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026116 1:27504738-27504760 GCCTGGCCGGCTGAGGTCACAGG No data
904026104_904026118 19 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026118 1:27504742-27504764 GGCCGGCTGAGGTCACAGGAAGG No data
904026104_904026114 2 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026114 1:27504725-27504747 GAGGCAGGGGCAGGCCTGGCCGG No data
904026104_904026112 -7 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026112 1:27504716-27504738 GGGAGGAGGGAGGCAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026104 Original CRISPR TCCTCCCCATTCTCACCAGA GGG (reversed) Intergenic
No off target data available for this crispr