ID: 904026110

View in Genome Browser
Species Human (GRCh38)
Location 1:27504711-27504733
Sequence GAATGGGGAGGAGGGAGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026099_904026110 -5 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026110 1:27504711-27504733 GAATGGGGAGGAGGGAGGCAGGG No data
904026092_904026110 30 Left 904026092 1:27504658-27504680 CCACTTGCTGGCTGGTGACCTTG No data
Right 904026110 1:27504711-27504733 GAATGGGGAGGAGGGAGGCAGGG No data
904026097_904026110 12 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026110 1:27504711-27504733 GAATGGGGAGGAGGGAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026110 Original CRISPR GAATGGGGAGGAGGGAGGCA GGG Intergenic
No off target data available for this crispr