ID: 904026111

View in Genome Browser
Species Human (GRCh38)
Location 1:27504712-27504734
Sequence AATGGGGAGGAGGGAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026099_904026111 -4 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026111 1:27504712-27504734 AATGGGGAGGAGGGAGGCAGGGG No data
904026097_904026111 13 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026111 1:27504712-27504734 AATGGGGAGGAGGGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026111 Original CRISPR AATGGGGAGGAGGGAGGCAG GGG Intergenic
No off target data available for this crispr