ID: 904026113

View in Genome Browser
Species Human (GRCh38)
Location 1:27504721-27504743
Sequence GAGGGAGGCAGGGGCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026104_904026113 -2 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026113 1:27504721-27504743 GAGGGAGGCAGGGGCAGGCCTGG No data
904026105_904026113 -3 Left 904026105 1:27504701-27504723 CCTCTGGTGAGAATGGGGAGGAG No data
Right 904026113 1:27504721-27504743 GAGGGAGGCAGGGGCAGGCCTGG No data
904026099_904026113 5 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026113 1:27504721-27504743 GAGGGAGGCAGGGGCAGGCCTGG No data
904026097_904026113 22 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026113 1:27504721-27504743 GAGGGAGGCAGGGGCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026113 Original CRISPR GAGGGAGGCAGGGGCAGGCC TGG Intergenic
No off target data available for this crispr