ID: 904026114

View in Genome Browser
Species Human (GRCh38)
Location 1:27504725-27504747
Sequence GAGGCAGGGGCAGGCCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026097_904026114 26 Left 904026097 1:27504676-27504698 CCTTGGGCGGGATACTGCCTGCT No data
Right 904026114 1:27504725-27504747 GAGGCAGGGGCAGGCCTGGCCGG No data
904026099_904026114 9 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026114 1:27504725-27504747 GAGGCAGGGGCAGGCCTGGCCGG No data
904026105_904026114 1 Left 904026105 1:27504701-27504723 CCTCTGGTGAGAATGGGGAGGAG No data
Right 904026114 1:27504725-27504747 GAGGCAGGGGCAGGCCTGGCCGG No data
904026104_904026114 2 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026114 1:27504725-27504747 GAGGCAGGGGCAGGCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026114 Original CRISPR GAGGCAGGGGCAGGCCTGGC CGG Intergenic
No off target data available for this crispr