ID: 904026116

View in Genome Browser
Species Human (GRCh38)
Location 1:27504738-27504760
Sequence GCCTGGCCGGCTGAGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026099_904026116 22 Left 904026099 1:27504693-27504715 CCTGCTTCCCTCTGGTGAGAATG No data
Right 904026116 1:27504738-27504760 GCCTGGCCGGCTGAGGTCACAGG No data
904026105_904026116 14 Left 904026105 1:27504701-27504723 CCTCTGGTGAGAATGGGGAGGAG No data
Right 904026116 1:27504738-27504760 GCCTGGCCGGCTGAGGTCACAGG No data
904026104_904026116 15 Left 904026104 1:27504700-27504722 CCCTCTGGTGAGAATGGGGAGGA No data
Right 904026116 1:27504738-27504760 GCCTGGCCGGCTGAGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026116 Original CRISPR GCCTGGCCGGCTGAGGTCAC AGG Intergenic
No off target data available for this crispr