ID: 904026635

View in Genome Browser
Species Human (GRCh38)
Location 1:27508026-27508048
Sequence GGTTCCAGTGGACAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904026635_904026641 1 Left 904026635 1:27508026-27508048 CCCTCCACTTGTCCACTGGAACC No data
Right 904026641 1:27508050-27508072 ATCAGTCCCCAGGTTCCGCTCGG No data
904026635_904026639 -9 Left 904026635 1:27508026-27508048 CCCTCCACTTGTCCACTGGAACC No data
Right 904026639 1:27508040-27508062 ACTGGAACCAATCAGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904026635 Original CRISPR GGTTCCAGTGGACAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr